Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMC3-proteasome (prosome, macropain) 26S subunit, ATPase, 3 Gene
PTXBC073165
New product
Data sheet of PSMC3-proteasome (prosome, macropain) 26S subunit, ATPase, 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMC3-proteasome (prosome, macropain) 26S subunit, ATPase, 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC073165 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMC3 |
| Origin species: | Human |
| Product name: | PSMC3-proteasome (prosome, macropain) 26S subunit, ATPase, 3 Gene |
| Size: | 2ug |
| Accessions: | BC073165 |
| Gene id: | 5702 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, ATPase, 3 |
| Synonyms: | TBP1; 26S protease regulatory subunit 6A; 26S proteasome AAA-ATPase subunit RPT5; TBP-1; Tat-binding protein 1; human immunodeficiency virus tat transactivator binding protein-1; proteasome (prosome, macropain) 26S subunit, ATPase, 3; proteasome subunit P50; testicular secretory protein Li 42; proteasome 26S subunit, ATPase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatctgctgccgaatattgagagtccagtgactcggcaggagaagatggcgaccgtgtgggatgaggccgagcaagatggaattggggaggaggtgctcaagatgtccacggaggagatcatccagcgcacacggctgctggacagtgagatcaagatcatgaagagtgaagtgttgagagtcacccatgagctccaagccatgaaggacaagataaaagagaacagtgagaaaatcaaagtgaacaagaccctgccgtaccttgtctccaacgtcatcgagctcctggatgttgatcctaatgaccaagaggaggatggtgccaatattgacctggactcccagaggaagggcaagtgtgctgtgatcaaaacctctacacgacagacgtacttccttcctgtgattgggttggtggatgctgaaaagctaaagccaggagacctggtgggtgtgaacaaagactcctatctgatcctggagacgctgcccacagagtatgactcgcgggtgaaggccatggaggtagacgagaggcccacggagcaatacagtgacattgggggtttggacaagcagatccaggagctggtggaggccattgtcttgccaatgaaccacaaggagaagtttgagaacttggggatccaacctccaaaaggggtgctgatgtatgggcccccagggacggggaagaccctcctggcccgggcctgtgccgcacagactaaggccaccttcctaaagctggctggcccccagctggtgcagatgttcattggagatggtgccaagctagtccgggatgcctttgccctggccaaggagaaagcgccctctatcatcttcattgatgagttggatgccatcggcaccaagcgctttgacagtgagaaggctggggaccgggaggtgcagaggacaatgctggagcttctgaaccagctggatggcttccagcccaacacccaagttaaggtaattgcagccacaaacagggtggacatcctggaccccgccctcctccgctcgggccgccttgaccgcaagatagagttcccgatgcccaatgaggaggcccgggccagaatcatgcagatccactcccgaaagatgaatgtcagtcctgacgtgaactacgaggagctggcccgctgcacagatgacttcaatggggcccagtgcaaggctgtgtgtgtggaggcgggcatgatcgcactgcgcaggggtgccacggagctcacccacgaggactacatggaaggcatcctggaggtgcaggccaagaagaaagccaacctacaatactacgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - triggering receptor expressed on myeloid cells-like 1 - cytochrome P450, family 2, subfamily F, polypeptide 1 - germ and embryonic stem cell enriched protein STELLA - proteasome (prosome, macropain) subunit, alpha type, 5 |