Cart 4 Product Products 528,01 € (empty)
-
1 x UTP3-UTP3,...121,50 € -
-
-
No products
To be determined Shipping
528,01 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 528,01 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 528,01 €
View larger 
ERMAP-erythroblast membrane-associated protein (Scianna blood group) Gene
PTXBC099703
New product
Data sheet of ERMAP-erythroblast membrane-associated protein (Scianna blood group) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ERMAP-erythroblast membrane-associated protein (Scianna blood group) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC099703 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ERMAP |
| Origin species: | Human |
| Product name: | ERMAP-erythroblast membrane-associated protein (Scianna blood group) Gene |
| Size: | 2ug |
| Accessions: | BC099703 |
| Gene id: | 114625 |
| Gene description: | erythroblast membrane-associated protein (Scianna blood group) |
| Synonyms: | BTN5; PRO2801; erythroid membrane-associated protein; Radin blood group (Rd); Scianna blood group (Sc); radin blood group antigen; scianna blood group antigen; erythroblast membrane associated protein (Scianna blood group) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagatggcgagttctgctggctcctggctctctggctgcctcatccctctcgtcttcctccggctgtctgtgcatgtgtcaggccacgcaggggatgccggcaagttccacgtggccctactagggggcacagccgagctgctctgccctctctccctctggcccgggacggtacccaaggaggtgaggtggctgcggtccccattcccgcagcgctcccaggctgttcacatattccgggatgggaaggaccaggatgaagatctgatgccggaatataaggggaggacggtgctagtgagagatgcccaagagggaagtgtcactctgcagatccttgacgtgcgccttgaggaccaagggtcttaccgatgtctgatccaagttggaaatctgagtaaagaggacaccgtgatcctgcaggttgcagccccatctgtggggagtctctccccctcagcagtggctctggctgtgatcctgcctgtcctggtacttctcatcatggtgtgcctttgccttatctggaagcaaagaagagcaaaagaaaagcttctctatgaacatgtgacggaggtggacaatcttctttcagaccatgctaaagaaaaaggaaaactccataaagctgtcaagaaactccggagtgaactgaagttgaaaagagctgcagcaaactcaggctggagaagagcccggttgcattttgtggcagtgaccctggacccagacacagcacatcccaaactcatcctttctgaggaccaaagatgtgtaaggcttggagacagacggcagcctgtacctgacaacccccagagatttgatttcgttgtcagcatcctaggctctgagtacttcacgactggctgccactactgggaggtgtatgtgggagacaagaccaaatggattcttggagtatgtagtgagtcagtgagcaggaaggggaaggttactgcctcacctgccaatggacactggcttctgcgacagagtcgtgggaatgagtatgaagctctcacatccccgcagacctccttccgccttaaagagcctccacggtgtgtggggattttcctggactatgaagcaggagtcatctctttctacaatgtgaccaacaagtcccacatctttactttcacccacaatttctctggcccccttcgccctttctttgaaccttgccttcatgatggaggaaaaaacacagcacctctagtcatttgttcagaactacacaaatcagaggaatcaattgtccccaggccagaagggaaaggccatgctaatggagatgtgtccctcaaggtgaactcttctttactacccccgaaggccccagagctgaaggatataatcctgtccttgccccctgaccttggcccagcccttcaggagctcaaggctccttctttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 12 - dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis) - blepharophimosis, epicanthus inversus and ptosis, candidate 1 - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) |