Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BPESC1-blepharophimosis, epicanthus inversus and ptosis, candidate 1 Gene
PTXBC119686
New product
Data sheet of BPESC1-blepharophimosis, epicanthus inversus and ptosis, candidate 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BPESC1-blepharophimosis, epicanthus inversus and ptosis, candidate 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC119686 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BPESC1 |
| Origin species: | Human |
| Product name: | BPESC1-blepharophimosis, epicanthus inversus and ptosis, candidate 1 Gene |
| Size: | 2ug |
| Accessions: | BC119686 |
| Gene id: | 60467 |
| Gene description: | blepharophimosis, epicanthus inversus and ptosis, candidate 1 |
| Synonyms: | NCRNA00187; blepharophimosis, epicanthus inversus and ptosis, candidate 1 (non-protein coding) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaggaagagatcaaatcacaaatcttgggagtgagggagagacacatccttggggctactcaagtcccccatatcctttgcataccttctttatcccttttctacccagtggatttggagggagtgggcttgggataccatcagacaacgagaaacacgatttgcaggactgtgtggaggtatccaggcctgagggccctgctccagagctcccctcctcactctgtggctggaacaaaatctcttccttgtgtggccttggcttccctagcagggatcccaaaacatgggatctggccatgctgctcagtccttgggttgatttctttgagctccagcttctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 - potassium inwardly-rectifying channel, subfamily J, member 11 - solute carrier family 29 (nucleoside transporters), member 3 |