Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MIF-macrophage migration inhibitory factor (glycosylation-inhibiting factor) Gene
PTXBC000447
New product
Data sheet of MIF-macrophage migration inhibitory factor (glycosylation-inhibiting factor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MIF-macrophage migration inhibitory factor (glycosylation-inhibiting factor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000447 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MIF |
| Origin species: | Human |
| Product name: | MIF-macrophage migration inhibitory factor (glycosylation-inhibiting factor) Gene |
| Size: | 2ug |
| Accessions: | BC000447 |
| Gene id: | 4282 |
| Gene description: | macrophage migration inhibitory factor (glycosylation-inhibiting factor) |
| Synonyms: | GIF; GLIF; MMIF; macrophage migration inhibitory factor; L-dopachrome isomerase; L-dopachrome tautomerase; phenylpyruvate tautomerase; macrophage migration inhibitory factor (glycosylation-inhibiting factor) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgatgttcatcgtaaacaccaacgtgccccgcgcctccgtgccggacgggttcctctccgagctcacccagcagctggcgcaggccaccggcaagcccccccagtacatcgcggtgcacgtggtcccggaccagctcatggccttcggcggctccagcgagccgtgcgcgctctgcagcctgcacagcatcggcaagatcggcggcgcgcagaaccgctcctacagcaagctgctgtgcggcctgctggccgagcgcctgcgcatcagcccggacagggtctacatcaactattacgacatgaacgcggccaatgtgggctggaacaactccaccttcgcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vesicle transport through interaction with t-SNAREs homolog 1B (yeast) - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B |