Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VTI1B-vesicle transport through interaction with t-SNAREs homolog 1B (yeast) Gene
PTXBC003142
New product
Data sheet of VTI1B-vesicle transport through interaction with t-SNAREs homolog 1B (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VTI1B-vesicle transport through interaction with t-SNAREs homolog 1B (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003142 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VTI1B |
| Origin species: | Human |
| Product name: | VTI1B-vesicle transport through interaction with t-SNAREs homolog 1B (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC003142 |
| Gene id: | 10490 |
| Gene description: | vesicle transport through interaction with t-SNAREs homolog 1B (yeast) |
| Synonyms: | VTI1; VTI1-LIKE; VTI1L; VTI2; v-SNARE; vti1-rp1; vesicle transport through interaction with t-SNAREs homolog 1B; vesicle transport v-SNARE protein Vti1-like 1; vesicle-associated soluble NSF attachment protein receptor; vesicle transport through interaction with t-SNAREs 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctcctccgccgcctcctcggagcatttcgagaagctgcacgagatcttccgcggcctccatgaagacctacaaggggtgcccgagcggctgctggggacggcggggaccgaagaaaagaagaaattgatcagggattttgatgaaaagcaacaggaagcaaatgaaacgctggcagagatggaggaggagctacgttatgcacccctgtctttccgaaaccccatgatgtctaagcttcgaaactaccggaaggaccttgctaaactccatcgggaggtgagaagcacacctttgacagccacacctggaggccgaggagacatgaaatatggcatatatgctgtagagaatgagcatatgaatcggctacagtctcaaagggcaatgcttctgcagggcactgaaagcctgaaccgggccacccaaagtattgaacgttctcatcggattgccacagagactgaccagattggctcagaaatcatagaagagctgggggaacaacgagaccagttagaacgtaccaagagtagactggtaaacacaagtgaaaacttgagcaaaagtcggaagattctccgttcaatgtccagaaaagtgacaaccaacaagctgctgctttccattatcatcttactggagctcgccatcctgggaggcctggtttactacaaattctttcgcagccattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B - signal recognition particle 14kDa (homologous Alu RNA binding protein) |