Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PVRL1-poliovirus receptor-related 1 (herpesvirus entry mediator C) Gene
PTXBC113471
New product
Data sheet of PVRL1-poliovirus receptor-related 1 (herpesvirus entry mediator C) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PVRL1-poliovirus receptor-related 1 (herpesvirus entry mediator C) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC113471 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PVRL1 |
| Origin species: | Human |
| Product name: | PVRL1-poliovirus receptor-related 1 (herpesvirus entry mediator C) Gene |
| Size: | 2ug |
| Accessions: | BC113471 |
| Gene id: | 5818 |
| Gene description: | poliovirus receptor-related 1 (herpesvirus entry mediator C) |
| Synonyms: | PVRL1; CD111; CLPED1; ED4; HIgR; HV1S; HVEC; OFC7; PRR; PRR1; PVRR; PVRR1; SK-12; nectin-1; ectodermal dysplasia 4 (Margarita Island type); herpes simplex virus type 1 sensitivity; herpes virus entry mediator C; herpesvirus Ig-like receptor; nectin 1; poliovirus receptor-like 1; poliovirus receptor-related 1 (herpesvirus entry mediator C); poliovirus receptor-related protein 1; nectin cell adhesion molecule 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcggatggggcttgcgggcgccgctggacgctggtggggactcgctctcggcttgaccgcattcttcctcccaggcgtccactcccaggtggtccaggtgaacgactccatgtatggcttcatcggcacagacgtggttctgcactgcagctttgccaacccgcttcccagcgtgaagatcacccaggtcacatggcagaagtccaccaatggctccaagcagaacgtggccatctacaacccatccatgggcgtgtccgtgctggctccctaccgcgagcgtgtggaattcctgcggccctccttcaccgatggcactatccgcctctcccgcctggagctggaggatgagggtgtctacatctgcgagtttgctaccttccctacgggcaatcgagaaagccagctcaatctcacggtgatggccaaacccaccaattggatagagggtacccaggcagtgcttcgagccaagaaggggcaggatgacaaggtcctggtggccacctgcacctcagccaatgggaagcctcccagtgtggtatcctgggaaactcggttaaaaggtgaggcagagtaccaggagatccggaaccccaatggcacagtgacggtcatcagccgctaccgcctggtgcccagcagggaagcccaccagcagtccttggcctgcatcgtcaactaccacatggaccgcttcaaggaaagcctcactctcaacgtgcagtatgagcctgaggtaaccattgaggggtttgatggcaactggtacctgcagcggatggacgtgaagctcacctgcaaagctgatgctaaccccccagccactgagtaccactggaccacgctaaatggctctctccccaagggtgtggaggcccagaacagaaccctcttcttcaagggacccatcaactacagcctggcagggacctacatctgtgaggccaccaaccccatcggtacacgctcaggccaggtggaggtcaatatcacagaattcccctacaccccgtctcctcccgaacatgggcggcgcgccgggccggtgcccacggccatcattgggggcgtggcggggagcatcctgctggtgttgattgtggtcggcgggatcgtggtcgccctgcgtcggcgccggcacaccttcaagggtgactacagcaccaagaagcacgtgtatggcaacggctacagcaaggcaggcatcccccagcaccacccaccaatggcacagaacctgcagtaccccgacgactcagacgacgagaagaaggccggcccactgggtggaagcagctatgaggaggaggaggaggaggaggagggcggtggagggggcgagcgcaaggtgggcggcccccaccccaaatatgacgaggacgccaagcggccctacttcaccgtggatgaggccgaggcccgtcaggacggctacggggaccggactctgggctaccagtacgaccctgagcagctggacttggctgagaacatggtttctcagaacgacgggtctttcatttccaagaaggagtggtacgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae) - serpin peptidase inhibitor, clade B (ovalbumin), member 7 - PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae) - Ras protein-specific guanine nucleotide-releasing factor 2 |