Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINB7-serpin peptidase inhibitor, clade B (ovalbumin), member 7 Gene
PTXBC106743
New product
Data sheet of SERPINB7-serpin peptidase inhibitor, clade B (ovalbumin), member 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB7-serpin peptidase inhibitor, clade B (ovalbumin), member 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106743 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB7 |
| Origin species: | Human |
| Product name: | SERPINB7-serpin peptidase inhibitor, clade B (ovalbumin), member 7 Gene |
| Size: | 2ug |
| Accessions: | BC106743 |
| Gene id: | 8710 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 7 |
| Synonyms: | MEGSIN; PPKN; TP55; serpin B7; mesangium predominant gene, megsin; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7; serpin peptidase inhibitor, clade B (ovalbumin), member 7; serpin family B member 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctcccttgctgcagcaaatgcagagttttgcttcaacctgttcagagagatggatgacaatcaaggaaatggaaatgtgttcttttcctctctgagcctcttcgctgccctggccctggtccgcttgggcgctcaagatgactccctctctcagattgataagttgcttcatgttaacactgcctcaggatatggaaactcttctaatagtcagtcagggctccagtctcaactgaaaagagttttttctgatataaatgcatcccacaaggattatgatctcagcattgtgaatgggctttttgctgaaaaagtgtatggctttcataaggactacattgagtgtgccgaaaaattatacgatgccaaagtggagcgagttgactttacgaatcatttagaagacactagacgtaatattaataagtgggttgaaaatgaaacacatggcaaaatcaagaacgtgattggtgaaggtggcataagctcatctgctgtaatggtgctggtgaatgctgtgtacttcaaaggcaagtggcaatcagccttcaccaagagcgaaaccataaattgccatttcaaatctcccaagtgctctgggaaggcagtcgccatgatgcatcaggaacggaagttcaatttgtctgttattgaggacccatcaatgaagattcttgagctcagatacaatggtggcataaacatgtacgttctgctgcctgagaatgacctctctgaaattgaaaacaaactgacctttcagaatctaatggaatggaccaatccaaggcgaatgacctctaagtatgttgaggtattttttcctcagttcaagatagagaagaattatgaaatgaaacaatatttgagagccctagggctgaaagatatctttgatgaatccaaagcagatctctctgggattgcttctgggggtcgtctgtatatatcaaggatgatgcacaaatcttacatagaggtcactgaggagggcaccgaggctactgctgccacaggaagtaatattgtagaaaagcaactccctcagtccacgctgtttagagctgaccacccattcctatttgttatcaggaaggatgacatcatcttattcagtggcaaagtttcttgcccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae) - Ras protein-specific guanine nucleotide-releasing factor 2 - protein phosphatase 1, regulatory (inhibitor) subunit 16B - ubiquitin protein ligase E3 component n-recognin 7 (putative) |