PNLDC1-poly(A)-specific ribonuclease (PARN)-like domain containing 1 Gene View larger

PNLDC1-poly(A)-specific ribonuclease (PARN)-like domain containing 1 Gene

PTXBC112246

New product

Data sheet of PNLDC1-poly(A)-specific ribonuclease (PARN)-like domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PNLDC1-poly(A)-specific ribonuclease (PARN)-like domain containing 1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC112246
Product type: DNA & cDNA
Ncbi symbol: PNLDC1
Origin species: Human
Product name: PNLDC1-poly(A)-specific ribonuclease (PARN)-like domain containing 1 Gene
Size: 2ug
Accessions: BC112246
Gene id: 154197
Gene description: poly(A)-specific ribonuclease (PARN)-like domain containing 1
Synonyms: poly(A)-specific ribonuclease PARN-like domain-containing protein 1; poly(A)-specific ribonuclease (PARN)-like domain containing 1; PARN like, ribonuclease domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttctgcacccgaggactgctattttttgccttcctggcaggtctggacatagagttcacgggccttcgttctaacctgtctgggccccagcagatcagtctttttgatttgccatcggagtggtatctaaagacccgtcagagtgttcagcaatttacagtctgtcagattggattgtctgtgttttccgctattgaaggagaggcaaacaagtatatagcccattcgtgtaacttctatctcttccctacaacgtttgggattttggactcagaattctccttccaggcttccagtgttcagtttttgaatcagtatggcttcaactataacaagtttctcaaaaacggaatcccatatatgaatgaagaacaggagaagaaaattagacacgatatcctgactgggaactggagagttcgcagctctccggataaagaccaaatcaaggtggtgattgacgaagtgacgcggtggctggagctggccaaggaaggcgactggatgactcttcctgggatcactggcttccaggcctttgaggtccaactggtgctgaggcaggccctccccaacatctggacggtgctgaaagatgagggggtggtagtgaagaaagtgagtaaacaacatcgttggtatcttcagaacacctcttgtgaccgagagagctgttggaaggaaaatattcttctctcagcaaggggtttttctgtctttttccaaatgctggtgaaagcccagaagcccttagtgggacataatatgatgatggacctgctgcacctccatgagaagttcttcagacccctcccagaaagctacgatcaatttaagcagaatatccacagcctatttcctgttctcattgataccaagagtgtaacaaaggatatctggaaggagatgaatttcccgagggtgtcgaatctttcggaagtctatgaagtcctgaacagtgacttgaatcccaccaagaattctggaccagagattgttcacgcgagcaggtgtgagaaatatgttgagacaaagtgcccccacgaagccgcgtatgatgccttcctctgtgggtcagttcttttgaaagtggcacacttgcttctacagaagatataccacatcgaccccgtgcccgagtcatcctttcctcagtaccttgacgtgctggctccttacgtgaaccaagtgaacctcatccgagcgggggtcccaaagatcaatttttctggtccagattatcccagtatccgacctcccatcctcatcctcagcgtcaaaaggtggcctggggtcagcgagcagcaagtctaccataagtttcagaatctctgcaagtttgatgtcaggcgactcacaagaagccagttcttactcctgaccaataagtttaaggatgcgcggaacatcctgaaggagtaccgggaccacccgaccctgtgcatctccctgtaccgctactggaggcactccccaaacgtcaactgcctgctccaagtctgtggcatagtgactgcctgggcccttctcgcgttcatccttggaagatctggtacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
- erythroblast membrane-associated protein (Scianna blood group)
- serpin peptidase inhibitor, clade B (ovalbumin), member 12
- dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)