Cart 1 Product Products 113,40 € (empty)
-
1 x STK32A-ser...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of WNK1-WNK lysine deficient protein kinase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WNK1-WNK lysine deficient protein kinase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021121 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WNK1 |
| Origin species: | Human |
| Product name: | WNK1-WNK lysine deficient protein kinase 1 Gene |
| Size: | 2ug |
| Accessions: | BC021121 |
| Gene id: | 65125 |
| Gene description: | WNK lysine deficient protein kinase 1 |
| Synonyms: | serine/threonine-protein kinase WNK1 2; serine/threonine-protein kinase WNK1 1; serine/threonine-protein kinase WNK1; HSAN2; HSN2; KDP; PPP1R167; PRKWNK1; PSK; p65; WNK lysine deficient protein kinase 1 isoform; erythrocyte 65 kDa protein; prostate-derived sterile 20-like kinase; protein kinase with no lysine 1; protein phosphatase 1, regulatory subunit 167; WNK lysine deficient protein kinase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctggcggcgccgcagagaagcagagcagcactcccggttccctgttcctctcgccgccggctcctgcccccaagaatggctccagctccgattcctccgtgggggagaaactgggagccgcggccgccgacgctgtgaccggcaggaccgaggagtacaggcgccgccgccacactatggacaaggacagccgtggggcggccgcgaccactaccaccactgagcaccgcttcttccgccggagcgtcatctgcgactccaatgccactgcactggagcttcccggccttcctctttccctgccccagcccagcatccccgcggctgtcccgcagagtgctccaccggagccccaccgggaagagaccgtgaccgccaccgccacttcccaggtagcccagcagcctccagccgctgccgcccctggggaacaggccgtcgcgggccctgccccctcgactgtccccagcagtaccagcaaagaccgcccagtgtcccagcctagccttgtggggagcaaagaggagccgccgccggcgagaagtggcagcggcggcggcagcgccaaggagccacaggaggaacggagccagcagcaggatgatatcgaagagctggagaccaaggccgtgggaatgtctaacgatggccgctttctcaagtttgacatcgaaatcggcagaggctcctttaagacggtctacaaaggtctggacactgaaaccaccgtggaagtcgcctggtgtgaactgcaggatcgaaaattaacaaagtctgagaggcagagatttaaagaagaagctgaaatgttaaaaggtcttcagcatcccaatattgttagattttatgattcctgggaatccacagtaaaaggaaagaagtgcattgttttggtgactgaacttatgacgtctggaacacttaaaacgtatctgaaaaggtttaaagtgatgaagatcaaagttctaagaagctggtgccgtcagatccttaaaggtcttcagtttcttcatactcgaactccacctatcattcaccgcgatcttaaatgtgacaacatctttatcaccggccctactggctcagtcaagattggagacctcggtctggcaaccctgaagcgggcttcttttgccaagagtgtgataggtatgtttcaggtgtaccttggagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 6 open reading frame 97 - mitochondrial ribosomal protein L20 - chromosome 1 open reading frame 87 - similar to RIKEN cDNA 2310039H08 |