PTXBC060325
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060325 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC441150 |
| Origin species: | Human |
| Product name: | LOC441150-similar to RIKEN cDNA 2310039H08 Gene |
| Size: | 2ug |
| Accessions: | BC060325 |
| Gene id: | 441150 |
| Gene description: | similar to RIKEN cDNA 2310039H08 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcgtccccgcagtccccaatgctcggccccggcctctgcctcagcttcggttaccctggcgcagctcctgcagctggtccagcagggccaggaactcccgggcctggagaaacgccacatcgcggcgatccacggcgaacccacagcgtcccggctgccgcggaggcccaagccctgggaggccgcggctttggctgagtcccttccccctccgaccctcaggataggaacggccccggcggagcctggcttggttgaggcagcgactgcgccttcttcatggcatacagtgggcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - immunoglobulin superfamily, member 8 - secretoglobin, family 1D, member 1 - chromosome 8 open reading frame 31 - secretoglobin, family 2A, member 2 |