C18orf34-chromosome 18 open reading frame 34 Gene View larger

C18orf34-chromosome 18 open reading frame 34 Gene

PTXBC130535

New product

Data sheet of C18orf34-chromosome 18 open reading frame 34 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf34-chromosome 18 open reading frame 34 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC130535
Product type: DNA & cDNA
Ncbi symbol: C18orf34
Origin species: Human
Product name: C18orf34-chromosome 18 open reading frame 34 Gene
Size: 2ug
Accessions: BC130535
Gene id: 374864
Gene description: chromosome 18 open reading frame 34
Synonyms: C18orf34; coiled-coil domain-containing protein 178; coiled-coil domain containing 178
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgaaaacaagacagtttcctcttcttccactagagatgatcaaaccaatataggtttaacatgtcaggaagtaaaggctctcagagagaaggcatggtcaaggacaaatgaaggcaatgccatgtctcaaagtttggttctatatggagcctctaaggagaacagtgaaggttttcatgaaagtaaaatgacaaatactgaaggggtgaataaaggcatttactttagctacccatgtcgacgtcacagctgtgccgtagtaaatattccagcaccttgtgtcaacaaaatgatttcacacatccaagatgtggagtccaaaatacaggagcatttgaaaaggtttgaaacttcttttgaagaatggagcagaacttcttccacaaaagacctgaaagaagattggagtgtaactacaccagtgaaagaggtcaaaccaggagaaaagagagatgaaaagtgtccagagttaaagcaggaaatggaaacattgctctcagaggccattcgtctcattaaaagtctagaaactgaccgggcagacgctgaagaagctttaaaacaacagagatcaagaaagaatatgattaacatgaaaattgactcttggtcagtctggaaacttcaagaactcccattggctgtgcagaaagaacatgaggcctatttgagtgatgttatagaattacaatggcatcttgaagataaagctaatcaactacaacattttgaaaaacaaaagacagagttagaagaagcaaatgcaaagattcaagcagacatagactacatgaatgaacatggccctctactggactctaagcagaatcaggaacttcaagatctgaagaaccattataaaaaaaaaatggaggtaatggacctacacagaaaagttaatgaagaacttgaagaagctttagaagcctgtgaaaatgccagattgaaggctcagcaaattaaagaagagattgataaggatatttaccaggatgaaaaaaccatagaggcctacaagagagagatatatcaacttaacagtctatttgatcattactcttcatcagtgataaatgttaatactaatattgaggagaaggaagaggaagtgactgaagcaataagggaaacaaagtcatcaaaaaatgaattacattctctatcaaaaatgctggaagatttgagaagagtttatgaccaactaacctggaagcaaaaaagtcatgaaaatcagtatctggaagcagttaatgatttttatgctgcaaaaaaaacatgggatattgagctttctgatgttgcaaaagatttttcagctatttctttggcatgtacaaaactgacggaagacaataaaaaacttgagattgatattaacaaaataacagaaaaaaccaatgaaagcatacggaaaaaatcaaaatacgaatctgaaataaaatatttgacaataatgaagttaaagaatgataaacatctcaagaacatctataaggaggcttatcgcattggtactcttttccacctaaccaaacacaagacagatgaaatggaagataaaatagcagaagtgagaagaaagttcaagggtagagaagaattcctgaaaaaactcactcaaggtgaagtggctgctggaatggtgcttcagaaaaaactatattccatttacgaagtccaggcacttgagcggaaagagcttataaaaaatagagcaatatgtgccatgtcactggcagaactacaggaacctctgcttcaactagaagatgaagctgaaagaatcagaagtctcaacaaagaacattctgttatgcttaataatataattgatcagaaagatcttattagaagaaaggtgggaaaagtaaagaaaaaattacgaaaaaaggggaagaaaacccttgatgcattaatagaaactgagagtaaacgctcagcaatttttaaagacctagaagcaactaaaagtaagacaatgattttttatgcaaaaataaatgaattgaatgaggaattaaaagcaaaagaagaagaaaagaaaagttttgatcagacacttgaaatattaaagaacaaatttataactatgagatttaaaagggaacatgcacaaactgtgtttgatcattatatgcaagagaaaaaagactgtgaagagagaatctttgaggaagatcagagatttagagtgctccttgctgtaagacaaaaaactcttcaagatacccaaaaaataatagctgattcacttgaagaaaatctgcgtttagctcaagagtatcaacagctacagattacattcttaaaagaaaaggacaattatttcaatatatatgataaacagctatcacttgatacttcaattagagataagaaacagctctgtcagctgcagagaaggatgcacacactgtggcaggagcacttcaaactggtggtcctcttcagccagatgaggctggccaacttccagacagactctcaggagagtattcagaaaatattagctgtgcaggaggaatcttcaaatttaatgcaacacatcttaggtttcttccagactttgacagatggcacatgcgaaaacgatggttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutamate receptor, ionotropic, AMPA 1
- family with sequence similarity 123C
- chromosome 19 open reading frame 15
- chromosome 20 open reading frame 12

Buy C18orf34-chromosome 18 open reading frame 34 Gene now

Add to cart