Login to display prices
Login to display prices
FAM123C-family with sequence similarity 123C Gene View larger

FAM123C-family with sequence similarity 123C Gene

PTXBC113445

New product

Data sheet of FAM123C-family with sequence similarity 123C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM123C-family with sequence similarity 123C Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC113445
Ncbi symbol: FAM123C
Product name: FAM123C-family with sequence similarity 123C Gene
Size: 2ug
Accessions: BC113445
Gene id: 205147
Gene description: family with sequence similarity 123C
Synonyms: protein FAM123C; FAM123C; APC membrane recruitment protein 3; family with sequence similarity 123C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgaagagaggaaagaccttcatcaagtccagcctgcaggtttcccacgagaaacccccagacccagcagccgtggctgcagccagggaggggacaggcccctggtcagtccttccaggagggcaacagaggccccacagtgagaagggcccccaagccagccccagtgcccaagaatacgacagatgccccaacaaaggggcgcagctggaccccaaagggggacccgcagccctctgtggagccaccttcaaaccggtgcgaaagtgcaagactcacgacagcatgtctggggcaggcagggccacggctgccacagggcagctggtgggcagtgcaagcttcccgggctccccgggcagccggcgcatgatcgactaccgccactttgtgccccagatgccctttgtgccagctgtggccaagagcatcccgaggaagaggatttccctgaagaggcccaagaagtgctttcggaacctattccacattcggagaaacaagactgaggacttggcctcgctggcggccgaggggaaaagcctgccctccccaggggacccgtcagaccctggggggcggcgaagcaaagccttcctccccccgggtgaggggccggggctggacggcctgtgccaggacctgttggacagcgagctcctggccgatgcatcctttggtctctgcagggccctgtgtgaggacgtggcctcactccagagcttcgactcgctcacgggttgtggggaggtgttcgcagatgagagctcggtgccatctctggagctgaacgagggcccggagagcccaacccaggctgctcagggcctggagagcaaggttcccaggggccctctccagggcagtgtggagcagctggcctcgcccgcccagaatgaagcctctgacttcaccaggttctgggacagtgtgaatcgctcagtgcgtcagcagcagcgtgccctcctaggcccgtggctttcaggcccccaggggacagacagggaccaaccccggctggacacagctgggctcgctgagctgcccctctgcccctgcagggaccctcgcagcggctccaaagccagctccatcgacacaggcacccccaagagcgagcagcccgaatccgtgtccacaagtgacgagggctactatgattccttctcgccaggacttgaggaggacaagaaggaagctgagagcccaggcactcctgccgccaccttcccacgggacagctacagtggggacgccctctacgagctcttccacgaccccagcgagggtcctcttggccccagcccagatgatgacctgtgcgtgtctgagagtctgtcagggccggccctggggacgccactgtccatatgcagcttccgagtgggggccgaggagaacttggccccagcaccaggccctgacctgctcagccagggcttcctacagagctcctggaagggcaaggagtgcctgctgaagctgtgtgacactgagctcgccatcaccatgggcatcgtcagctggctgcgccgaggccccacgccccgtgccccacccacccctgggcagcctgcagctccacctggttcccagggagcccctagggcacccacagagaagctggggggcagggagggcctggcctcagatgcagggggggcgacagtttgctcagcacccagcaggcaggagctgtgggcacacccgggcaccacaggcctgctcgccggagagagcaaggccctcggaggggccacacaagggactggcacactgtccagggatgcctctcgagaggaagagacacgaggtcactctgaaggcttgttctcctctatggagtctgcagccacttcgacaacagatacttccggtaaaaataaggccccagttccttctacctggccctgctcccagaaggagcctgggccaccaggggtcctggggtgtttccgaggcccctggaggccaggtcacggaggtgacactctggatgcagagcccatgctggcaggctgtgtggcccgtgtggcagccctgaagatcagctcaaacgaacagcccccggccgcatggcctccaaggcaagacatgggcagtgggctctttgggcagcgctgggccaggggccctgacatgctggagcagaaacagtccagcagctcccccagcatgaccaccatccatggcctaccctactcagccagcacacaggaccagaggtgtcgagatcgtgtccaggacctgagctggctcagggtggagcccaccgggctaggtgtccaggcctgggcctctgtggaggaccagcccttgcagctcagcacagaggctgtggagcaggtggcacacggcagccagctggactctgagccccgctcagcccctgctgcccggtggagttcccagggccaccatccagaaagcctgggcctcactttgaacagccagcaggaagggggggtctctgcaagtgccccagaatgccgctgcagcctcctggcccgtgagggcctcctctgtggccagccagaagtgggggcctctgggccagccatggctgagccccatctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: