Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
B3GNTL1-UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 Gene
PTXBC110529
New product
Data sheet of B3GNTL1-UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about B3GNTL1-UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC110529 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | B3GNTL1 |
| Origin species: | Human |
| Product name: | B3GNTL1-UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC110529 |
| Gene id: | 146712 |
| Gene description: | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 |
| Synonyms: | 3-Gn-T8; B3GNT8; BGnT-8; beta-1; beta3Gn-T8; beta3GnTL1; UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like protein 1; BGnT-like protein 1; UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8; beta-1,3-Gn-T8; beta-1,3-N-acetylglucosaminyltransferase 8; beta1,3-N-acetylglucosaminyltransferase-like protein 1; beta3Gn-T-like protein 1; UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgtctatgttggttgtgaacgtgcatttggcacctggcagggccaaccctcatggcgtgtgcgtgaacacatccctaaaccatagtctaatttatcctatttttgtagttcatgtgagcagaatccagtgtctgtgttctcgcatctggttttcactccacgtgtttggggtgtgtgcgtatcgctgtgcatggtgtggactttctccacgtcccgtgtgcaaacgccaccccacccagaggccacgccaggacccaggcctgtgggcagtggttcccggtttgcccttgcaaggacgctgtgtcctcctgcgtgagcatccctgcctcgggtctaatcctgggagtggaaggcaggtcgtgggtgtggctgcatcctcagcttctctggatgatgcccaggaacatgcccagagccagagggcccagctgctcggctccctcacactgggctgggcacttggtcgccagccgtttggggagtgtgttctcatggtggtttcaggtgtgagtctgaccaacaaccccccgtgcccgctggacactggagttccttcctctctggcggtgtttctcatcagggttccccaccggcctactgcacgctgcgtctctcctgacctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ELOVL family member 7, elongation of long chain fatty acids (yeast) - M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) - potassium voltage-gated channel, subfamily H (eag-related), member 1 - leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 |