Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ELOVL7-ELOVL family member 7, elongation of long chain fatty acids (yeast) Gene
PTXBC130310
New product
Data sheet of ELOVL7-ELOVL family member 7, elongation of long chain fatty acids (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELOVL7-ELOVL family member 7, elongation of long chain fatty acids (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130310 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELOVL7 |
| Origin species: | Human |
| Product name: | ELOVL7-ELOVL family member 7, elongation of long chain fatty acids (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC130310 |
| Gene id: | 79993 |
| Gene description: | ELOVL family member 7, elongation of long chain fatty acids (yeast) |
| Synonyms: | 3-keto acyl-CoA synthase ELOVL7; elongation of very long chain fatty acids protein 7; ELOVL FA elongase 7; ELOVL family member 7, elongation of long chain fatty acids; very long chain 3-ketoacyl-CoA synthase 7; very long chain 3-oxoacyl-CoA synthase 7; ELOVL fatty acid elongase 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccttcagtgatcttacatcgaggactgtgcatctttatgataattggatcaaagatgctgatccaagagttgaagattggctcctcatgtcctcgcctctgccacaaaccatcctcctaggattctatgtctattttgtcacttccttgggaccaaagctcatggaaaatcgcaagccctttgaactcaagaaagcaatgataacgtacaattttttcatagtactcttttctgtgtatatgtgttatgagtttgtgatgtctggctggggtataggttattcatttcgatgtgacattgttgactattcacggtcacccacagctttgaggatggcacgtacctgctggctttattacttctccaaatttattgagctattagatacgatcttttttgttctgcgcaagaaaaatagccaagtgactttccttcatgtattccatcataccatcatgccgtggacctggtggtttggagtcaaatttgctgcaggtggtttgggaacattccatgcccttctaaatacagctgtacatgtagtcatgtattcctactatggactttctgcattggggccagcctaccagaagtatttgtggtggaaaaaatatttgacatcattacagcttgtccagtttgttattgtcgccatccacataagccagttctttttcatggaggattgcaagtatcagtttccagtctttgcgtgcatcattatgagttacagtttcatgtttctgctgctctttctccatttttggtaccgtgcttacaccaaaggtcagaggttgcccaaaactgtgaaaaatggaacttgcaaaaacaaagataattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) - potassium voltage-gated channel, subfamily H (eag-related), member 1 - leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 - eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa |