No products
Prices are tax excluded
PTXBC130310
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC130310 |
Product type: | DNA & cDNA |
Ncbi symbol: | ELOVL7 |
Origin species: | Human |
Product name: | ELOVL7-ELOVL family member 7, elongation of long chain fatty acids (yeast) Gene |
Size: | 2ug |
Accessions: | BC130310 |
Gene id: | 79993 |
Gene description: | ELOVL family member 7, elongation of long chain fatty acids (yeast) |
Synonyms: | 3-keto acyl-CoA synthase ELOVL7; elongation of very long chain fatty acids protein 7; ELOVL FA elongase 7; ELOVL family member 7, elongation of long chain fatty acids; very long chain 3-ketoacyl-CoA synthase 7; very long chain 3-oxoacyl-CoA synthase 7; ELOVL fatty acid elongase 7 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggccttcagtgatcttacatcgaggactgtgcatctttatgataattggatcaaagatgctgatccaagagttgaagattggctcctcatgtcctcgcctctgccacaaaccatcctcctaggattctatgtctattttgtcacttccttgggaccaaagctcatggaaaatcgcaagccctttgaactcaagaaagcaatgataacgtacaattttttcatagtactcttttctgtgtatatgtgttatgagtttgtgatgtctggctggggtataggttattcatttcgatgtgacattgttgactattcacggtcacccacagctttgaggatggcacgtacctgctggctttattacttctccaaatttattgagctattagatacgatcttttttgttctgcgcaagaaaaatagccaagtgactttccttcatgtattccatcataccatcatgccgtggacctggtggtttggagtcaaatttgctgcaggtggtttgggaacattccatgcccttctaaatacagctgtacatgtagtcatgtattcctactatggactttctgcattggggccagcctaccagaagtatttgtggtggaaaaaatatttgacatcattacagcttgtccagtttgttattgtcgccatccacataagccagttctttttcatggaggattgcaagtatcagtttccagtctttgcgtgcatcattatgagttacagtttcatgtttctgctgctctttctccatttttggtaccgtgcttacaccaaaggtcagaggttgcccaaaactgtgaaaaatggaacttgcaaaaacaaagataattga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) - potassium voltage-gated channel, subfamily H (eag-related), member 1 - leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 - eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa |