Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C10orf114-chromosome 10 open reading frame 114 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C10orf114-chromosome 10 open reading frame 114 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130594 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C10orf114 |
| Origin species: | Human |
| Product name: | C10orf114-chromosome 10 open reading frame 114 Gene |
| Size: | 2ug |
| Accessions: | BC130594 |
| Gene id: | 399726 |
| Gene description: | chromosome 10 open reading frame 114 |
| Synonyms: | C10orf114; bA418C1.3; protein CASC10; cancer susceptibility candidate gene 10 protein; cancer susceptibility candidate 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaatcgcgggagccctcagggtggcgcacggcggagaggcgacgcgggtggcgctgcagaggcgtccccaccccctccggggaccggggccccggagctgccaggcccgctgcacgcggcggcgcgggagaaaccacggggcagcagcgccccctgcaggtgccgggcgcctccgcagccgctgcgcggacccgactcttaaggtggcaccaccgggttcccagcccgcgcgcaacccgcagccctggctccatccgccgcacttctccctgtagcggcgggcctgaccgtccggaacggccggagtgtgctgatgcctgctgctatctgcttgatcccttcaccctacctctcatccaggacttcttccgcggatgcgcagctagcgatttcgacaggcgagattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - placenta-specific 2 (non-protein coding) - ras homolog gene family, member G (rho G) - ropporin, rhophilin associated protein 1 - C-type lectin domain family 3, member A |