Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ROPN1-ropporin, rhophilin associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ROPN1-ropporin, rhophilin associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132744 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ROPN1 |
| Origin species: | Human |
| Product name: | ROPN1-ropporin, rhophilin associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC132744 |
| Gene id: | 54763 |
| Gene description: | ropporin, rhophilin associated protein 1 |
| Synonyms: | CT91; ODF6; RHPNAP1; ROPN1A; ropporin; ropporin-1A; cancer/testis antigen 91; outer dense fiber of sperm tails 6; rhophilin-associated protein 1A; ropporin, rhophilin associated protein 1; testis secretory sperm-binding protein Li 239w; rhophilin associated tail protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcagacagataagccaacatgcatcccgccggagctgccgaagatgctgaaggagtttgccaaagccgccattagggtgcagccgcaggacctcatccagtgggcagccgattattttgaggccctgtcccgtggagagacgcctccggtgagagagcggtctgagcgagtcgctttgtgtaaccgggcagagctaacacctgagctgttaaagatcctgcattctcaggttgctggcagactgatcatccgtgcagaggagctggcccagatgtggaaagtggtgaatctcccaacagatctgtttaatagtgtgatgaatgtgggtcgcttcacggaggagatcgagtggctgaagtttttagcccttgcttgcagcgctctgggagttactattaccaaaactctcaagatagtgtgtgaggtcttatcatgtgaccataatggtgggtcgccccggatcccgttcagcaccttccagtttctctacacgtatattgccaaagtggatggggagatctctgcatcacatgtcagcaggatgctaaactacatggaacaggaagtaattggccctgatggtataatcacagtgaatgactttacccaaaaccccagggttcagctggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C-type lectin domain family 3, member A - chromosome 20 open reading frame 118 - transcription factor Dp family, member 3 - hydroxyacid oxidase (glycolate oxidase) 1 |