Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LITAF-lipopolysaccharide-induced TNF factor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LITAF-lipopolysaccharide-induced TNF factor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101401 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LITAF |
| Origin species: | Human |
| Product name: | LITAF-lipopolysaccharide-induced TNF factor Gene |
| Size: | 2ug |
| Accessions: | BC101401 |
| Gene id: | 9516 |
| Gene description: | lipopolysaccharide-induced TNF factor |
| Synonyms: | PIG7; SIMPLE; TP53I7; lipopolysaccharide-induced tumor necrosis factor-alpha factor; LPS-induced TNF-alpha factor; lipopolysaccharide-induced TNF-alpha factor; p53-induced gene 7 protein; small integral membrane protein of lysosome/late endosome; tumor protein p53 inducible protein 7; lipopolysaccharide induced TNF factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggttccaggaccttaccaggcggccactgggccttcctcagcaccatccgcacctccatcctatgaagagacagtggctgttaacagttattaccccacacctccagctcccatgcctgggccaactacggggcttgtgacggggcctgatgggaagggcatgaatcctccttcgtattatacccagccagcgcccatccccaataacaatccaattaccgtgcagacggtctacgtgcagcaccccatcacctttttggaccgccctatccaaatgtgttgtccttcctgcaacaagatgatcgtgagtcagctgtcctataacgccggtgctctgacctggctgtcctgcgggagcctgtgcctgctggggtgcatagcgggctgctgcttcatccccttctgcgtggatgccctgcaggacgtggaccattactgtcccaactgcagagctctcctgggcacctacaagcgtttgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD3g molecule, gamma (CD3-TCR complex) - SRY (sex determining region Y)-box 14 - coiled-coil domain containing 102B - keratin associated protein 10-11 |