Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CD3G-CD3g molecule, gamma (CD3-TCR complex) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD3G-CD3g molecule, gamma (CD3-TCR complex) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113830 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD3G |
| Origin species: | Human |
| Product name: | CD3G-CD3g molecule, gamma (CD3-TCR complex) Gene |
| Size: | 2ug |
| Accessions: | BC113830 |
| Gene id: | 917 |
| Gene description: | CD3g molecule, gamma (CD3-TCR complex) |
| Synonyms: | CD3g molecule; CD3g molecule, gamma (CD3-TCR complex); CD3g molecule, epsilon (CD3-TCR complex); CD3g antigen, gamma polypeptide (TiT3 complex); CD3-GAMMA; IMD17; T3G; T-cell surface glycoprotein CD3 gamma chain; T-cell antigen receptor complex, gamma subunit of T3; T-cell receptor T3 gamma chain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacaggggaagggcctggctgtcctcatcctggctatcattcttcttcaaggtactttggcccagtcaatcaaaggaaaccacttggttaaggtgtatgactatcaagaagatggttcggtacttctgacttgtgatgcagaagccaaaaatatcacatggtttaaagatgggaagatgatcggcttcctaactgaagataaaaaaaaatggaatctgggaagtaatgccaaggaccctcgagggatgtatcagtgtaaaggatcacagaacaagtcaaaaccactccaagtgtattacagaatgtgtcagaactgcattgaactaaatgcagccaccatatctggctttctctttgctgaaatcgtcagcattttcgtccttgctgttggggtctacttcattgctggacaggatggagttcgccagtcgagagcttcagacaagcagactctgttgcccaatgaccagctctaccagcccctcaaggatcgagaagatgaccagtacagccaccttcaaggaaaccagttgaggaggaattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SRY (sex determining region Y)-box 14 - coiled-coil domain containing 102B - keratin associated protein 10-11 - hereditary sensory neuropathy, type II |