PTXBC106881
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106881 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5G3 |
| Origin species: | Human |
| Product name: | ATP5G3-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) Gene |
| Size: | 2ug |
| Accessions: | BC106881 |
| Gene id: | 518 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) |
| Synonyms: | ATP synthase F(0) complex subunit C3, mitochondrial; ATP synthase lipid-binding protein, mitochondrial; ATP synthase proteolipid P3; ATP synthase proton-transporting mitochondrial F(0) complex subunit C3; ATP synthase subunit 9; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9); ATP synthase, mitochondrial, C subunit-3; ATPase protein 9; ATPase subunit C; ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcgcctgcgccaagctcgcctgcaccccctctctgatccgagctggatccagagttgcatacagaccaatttctgcatcagtgttatctcgaccagaggctagtaggactggagagggctctacggtatttaatggggcccagaatggtgtgtctcagctaatccaaagggagtttcagaccagtgcaatcagcagagacattgatactgctgccaaatttattggtgcaggtgctgcaacagtaggagtggctggttctggtgctggtattggaacagtctttggcagccttatcattggttatgccagaaacccttcgctgaagcagcagctgttctcatatgctatcctgggatttgccttgtctgaagctatgggtctcttttgtttgatggttgctttcttgattttgtttgccatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) - sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C - TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa |