Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SPANXD-SPANX family, member D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPANXD-SPANX family, member D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103961 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPANXD |
| Origin species: | Human |
| Product name: | SPANXD-SPANX family, member D Gene |
| Size: | 2ug |
| Accessions: | BC103961 |
| Gene id: | 64648 |
| Gene description: | SPANX family, member D |
| Synonyms: | CT11.4; SPANX-C; SPANX-D; SPANX-E; SPANXE; dJ171K16.1; sperm protein associated with the nucleus on the X chromosome D; SPANX family, member E; cancer/testis antigen 11.4; cancer/testis antigen family 11, member 4; nuclear-associated protein SPAN-Xd; nuclear-associated protein SPAN-Xe; sperm protein associated with the nucleus, X chromosome, family member D; sperm protein associated with the nucleus, X chromosome, family member E; SPANX family member D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgattccaacgaggccaacgagatgatgccggagacctcgagtgggtactcagacccgcaacctgctccgaaaaaactaaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaactttaaaagaacatctccagaggaactggtgaatgaccacgcccgaaagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - variable charge, Y-linked - acyl-CoA thioesterase 6 - cancer/testis antigen 2 - FLJ46257 protein |