Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CTAG2-cancer/testis antigen 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CTAG2-cancer/testis antigen 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113998 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTAG2 |
| Origin species: | Human |
| Product name: | CTAG2-cancer/testis antigen 2 Gene |
| Size: | 2ug |
| Accessions: | BC113998 |
| Gene id: | 30848 |
| Gene description: | cancer/testis antigen 2 |
| Synonyms: | CAMEL; CT2; CT6.2; CT6.2a; CT6.2b; ESO2; LAGE-1; LAGE2B; cancer/testis antigen 2; CTL-recognized antigen on melanoma; LAGE-1a protein; autoimmunogenic cancer/testis antigen NY-ESO-2; cancer/testis antigen 6.2; cancer/testis antigen family 6, member 2a; cancer/testis antigen family 6, member 2b; l antigen family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggccgaaggccggggcacagggggttcgacgggcgatgctgatggcccaggaggccctggcattcctgatggcccagggggcaatgctggcggcccaggagaggcgggtgccacgggcggcagaggtccccggggcgcaggggcagcaagggcctcggggccgagaggaggcgccccgcggggtccgcatggcggtgccgcttctgcgcaggatggaaggtgcccctgcggggccaggaggccggacagccgcctgcttgagttgcacatcacgatgcctttctcgtcgcccatggaagcggagctggtccgcaggatcctgtcccgggatgccgcaccgctcccccgaccaggggcggttctgaaggacttcaccgtgtccggcaacctactgtttatccgactgactgctgcagaccaccgccaactgcagctctccatcagctcctgtctccagcagctttccctgttgatgtggatcacgcagtgctttctgcccgtgtttttggctcaggctccctcagggcagaggcgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FLJ46257 protein - acyl-CoA thioesterase 8 - endonuclease G-like 1 - somatostatin receptor 4 |