Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of COX8C-cytochrome c oxidase subunit 8C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX8C-cytochrome c oxidase subunit 8C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101126 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX8C |
| Origin species: | Human |
| Product name: | COX8C-cytochrome c oxidase subunit 8C Gene |
| Size: | 2ug |
| Accessions: | BC101126 |
| Gene id: | 341947 |
| Gene description: | cytochrome c oxidase subunit 8C |
| Synonyms: | COX8-3; cytochrome c oxidase subunit 8C, mitochondrial; COX VIII-3; cytochrome c oxidase polypeptide 8; cytochrome c oxidase polypeptide VIII; cytochrome c oxidase subunit 8-3; cytochrome c oxidase subunit VIII; cytochrome c oxidase subunit VIIIC; cytochrome c oxidase subunit 8C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctctcctgcgtgggcgctgtcctgcccgccgccactaccgccgcttggccctgctcggcctgcagcccgctccccgcttcgcccactcggggcccccgcgccagcggcccctgtctgccgcggaaatggctgttggacttgtggtgttttttacgaccttcttaacaccagctgcatatgtgctaggcaacctgaagcagttcagaaggaattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pyroglutamylated RFamide peptide - TBC1 domain family, member 29 - guanylate cyclase activator 1C - chromatin modifying protein 1A |