Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CHMP1A-chromatin modifying protein 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHMP1A-chromatin modifying protein 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132711 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHMP1A |
| Origin species: | Human |
| Product name: | CHMP1A-chromatin modifying protein 1A Gene |
| Size: | 2ug |
| Accessions: | BC132711 |
| Gene id: | 5119 |
| Gene description: | chromatin modifying protein 1A |
| Synonyms: | CHMP1; PCH8; PCOLN3; PRSM1; VPS46-1; VPS46A; charged multivesicular body protein 1a; charged multivesicular body protein 1/chromatin modifying protein 1; chromatin modifying protein 1A; procollagen (type III) N-endopeptidase; protease, metallo, 1, 33kD; vacuolar protein sorting-associated protein 46-1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgataccctgttccagttgaagttcacggcgaagcagctggagaagctggccaagaaggcggagaaggactccaaggcggagcaggccaaagtgaagaaggcccttctgcagaaaaatgtagagtgtgcccgtgtgtatgccgagaacgccatccgcaagaagaacgaaggtgtgaactggcttcggatggcgtcccgcgtagacgcagtggcctccaaggtgcagacagctgtgactatgaagggggtgaccaagaatatggcccaggtgaccaaagccctggacaaggccctgagcaccatggacctgcagaaggtctcctcagtgatggacaggttcgagcagcaggtgcagaacctggacgtccatacatcggtgatggaggactccatgagctcggccaccaccctgaccacgccgcaggagcaggtggacagcctcatcatgcagatcgccgaggagaatggcctggaggtgctggaccagctcagccagctgcccgagggcgcctctgccgtgggcgagagctctgtgcgcagccaggaggaccagctgtcacggaggttggccgccttgaggaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synovial sarcoma, X breakpoint 1 - ADP-ribosylation factor-like 16 - G protein-coupled receptor 119 - chromatin modifying protein 4A |