No products
Prices are tax excluded
PTXBC126434
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126434 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LBH |
| Origin species: | Human |
| Product name: | LBH-limb bud and heart development homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC126434 |
| Gene id: | 81606 |
| Gene description: | limb bud and heart development homolog (mouse) |
| Synonyms: | protein LBH; hLBH; limb bud and heart development homolog; limb bud and heart development |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctatatatttccccattcactgccccgactatctgagatcggccaagatgactgaggtgatgatgaacacccagcccatggaggagatcggcctcagcccccgcaaggatggcctttcctaccagatcttcccagacccgtcagattttgaccgctgctgcaaactgaaggaccgtctgccctccatagtggtggaacccacagaaggggaggtggagagcggggagctccggtggccccctgaggagttcctggtccaggaggatgagcaagataactgcgaagagacagcgaaagaaaataaagagcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - achaete-scute complex homolog 2 (Drosophila) - alkB, alkylation repair homolog 3 (E. coli) - hydroxysteroid (17-beta) dehydrogenase 13 - V-set and immunoglobulin domain containing 8 |