Cart 18 Product Products 7 005,06 € (empty)
-
1 x CMA1-chyma...113,40 € -
-
-
-
-
-
-
-
-
1 x ZNF785...259,07 € -
-
-
1 x C3orf42-ch...113,40 € -
1 x TEKT5-tekt...121,50 € -
1 x ZNF488-zin...113,40 € -
-
-
No products
To be determined Shipping
7 005,06 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 005,06 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 005,06 €
View larger 
Data sheet of ASCL2-achaete-scute complex homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASCL2-achaete-scute complex homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057801 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASCL2 |
| Origin species: | Human |
| Product name: | ASCL2-achaete-scute complex homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC057801 |
| Gene id: | 430 |
| Gene description: | achaete-scute complex homolog 2 (Drosophila) |
| Synonyms: | ASH2; HASH2; MASH2; bHLHa45; achaete-scute homolog 2; ASH-2; achaete-scute complex homolog 2; achaete-scute complex-like 2; class A basic helix-loop-helix protein 45; mammalian achaete/scute homologue 2; achaete-scute family bHLH transcription factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacggcggcacactgcccaggtccgcgccccctgcgccccccgtccctgtcggctgcgctgcccggcggagacccgcgtccccggaactgttgcgctgcagccggcggcggcgaccggccaccgcagagaccggaggcggcgcagcggccgtagcgcggcgcaatgagcgcgagcgcaaccgcgtgaagctggtgaacttgggcttccaggcgctgcggcagcacgtgccgcacggcggcgccagcaagaagctgagcaaggtggagacgctgcgctcagccgtggagtacatccgcgcgctgcagcgcctgctggccgagcacgacgccgtgcgcaacgcgctggcgggagggctgaggccgcaggccgtgcggccgtctgcgccccgcgggccgccagggaccaccccggtcgccgcctcgccctcccgcgcttcttcgtccccgggccgcgggggcagctcggagcccggctccccgcgttccgcctactcgtcggacgacagcggctgcgaaggcgcgctgagtcctgcggagcgcgagctactcgacttctccagctggttagggggctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - alkB, alkylation repair homolog 3 (E. coli) - hydroxysteroid (17-beta) dehydrogenase 13 - V-set and immunoglobulin domain containing 8 - oxidative stress induced growth inhibitor 1 |