Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of OCC-1-overexpressed in colon carcinoma-1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OCC-1-overexpressed in colon carcinoma-1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC045812 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OCC-1 |
| Origin species: | Human |
| Product name: | OCC-1-overexpressed in colon carcinoma-1 Gene |
| Size: | 2ug |
| Accessions: | BC045812 |
| Gene id: | 387882 |
| Gene description: | overexpressed in colon carcinoma-1 |
| Synonyms: | OCC-1; overexpressed in colon carcinoma 1 protein homolog; overexpressed in colon carcinoma 1 homolog; chromosome 12 open reading frame 75 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactcaagaatcaagagcttgctcatcagtttggaaggaatttggctccgtgggacgttgtaatgtgcacagacatttccaaggaaattctaaacagtcacccttcccttttgcattcccccaaatcttaagtgtatacataaaaccctgggtacatattgttgtggtaatagaagggaattggttaaacagtacacttgtttatggaactttctgtggccacctacgaaagacaagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycophorin C (Gerbich blood group) - hypothetical protein LOC440905 - regenerating islet-derived 3 gamma - hypothetical protein LOC348262 |