Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of REG3G-regenerating islet-derived 3 gamma Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about REG3G-regenerating islet-derived 3 gamma Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103854 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | REG3G |
| Origin species: | Human |
| Product name: | REG3G-regenerating islet-derived 3 gamma Gene |
| Size: | 2ug |
| Accessions: | BC103854 |
| Gene id: | 130120 |
| Gene description: | regenerating islet-derived 3 gamma |
| Synonyms: | LPPM429; PAP IB; PAP-1B; PAP1B; PAPIB; REG-III; UNQ429; regenerating islet-derived protein 3-gamma; REG-3-gamma; pancreatitis-associated protein 1B; pancreatitis-associated protein IB; reg III-gamma; regenerating gene III; regenerating islet-derived 3 gamma; regenerating islet-derived protein III-gamma; regenerating family member 3 gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcctcccatggccctgcccagtgtgtcctggatgctgctttcctgcctcattctcctgtgtcaggttcaaggtgaagaaacccagaaggaactgccctctccacggatcagctgtcccaaaggctccaaggcctatggctccccctgctatgccttgtttttgtcaccaaaatcctggatggatgcagatctggcttgccagaagcggccctctggaaaactggtgtctgtgctcagtggggctgagggatccttcgtgtcctccctggtgaggagcattagtaacagctactcatacatctggattgggctccatgaccccacacagggctctgagcctgatggagatggatgggagtggagtagcactgatgtgatgaattactttgcatgggagaaaaatccctccaccatcttaaaccctggccactgtgggagcctgtcaagaagcacaggatttctgaagtggaaagattataactgtgatgcaaagttaccctatgtctgcaagttcaaggactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein LOC348262 - hypothetical protein LOC338809 - dickkopf homolog 4 (Xenopus laevis) - hypothetical protein LOC339524 |