Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SNRPF-small nuclear ribonucleoprotein polypeptide F Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRPF-small nuclear ribonucleoprotein polypeptide F Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063397 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRPF |
| Origin species: | Human |
| Product name: | SNRPF-small nuclear ribonucleoprotein polypeptide F Gene |
| Size: | 2ug |
| Accessions: | BC063397 |
| Gene id: | 6636 |
| Gene description: | small nuclear ribonucleoprotein polypeptide F |
| Synonyms: | SMF; Sm-F; snRNP-F; small nuclear ribonucleoprotein F; sm protein F; small nuclear ribonucleoprotein polypeptide F |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtttacccctcaatcccaaacctttcctcaatggactaacaggaaagccagtgatggtgaaacttaagtggggaatggagtacaagggctatctggtatctgtagatggctacatgaacatgcagcttgcaaatacagaagaatacatagatggagctttgtctggacatctgggtgaagttttaataaggtgtaataatgtcctttatatcagaggtgtggaagaagaggaagaagatggggaaatgagagaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribonuclease, RNase A family, 9 (non-active) - sodium channel, voltage-gated, type III, beta - tubulin tyrosine ligase-like family, member 9 - cyclic nucleotide binding domain containing 1 |