Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SCN3B-sodium channel, voltage-gated, type III, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCN3B-sodium channel, voltage-gated, type III, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117282 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCN3B |
| Origin species: | Human |
| Product name: | SCN3B-sodium channel, voltage-gated, type III, beta Gene |
| Size: | 2ug |
| Accessions: | BC117282 |
| Gene id: | 55800 |
| Gene description: | sodium channel, voltage-gated, type III, beta |
| Synonyms: | ATFB16; BRGDA7; HSA243396; SCNB3; sodium channel subunit beta-3; sodium channel, voltage-gated, type III, beta subunit; voltage-gated sodium channel beta-3 subunit; sodium voltage-gated channel beta subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgccttcaatagattgtttcccctggcttctctcgtgcttatctactgggtcagtgtctgcttccctgtgtgtgtggaagtgccctcggagacggaggccgtgcagggcaaccccatgaagctgcgctgcatctcctgcatgaagagagaggaggtggaggccaccacggtggtggaatggttctacaggcccgagggcggtaaagatttccttatttacgagtatcggaatggccaccaggaggtggagagcccctttcaggggcgcctgcagtggaatggcagcaaggacctgcaggacgtgtccatcactgtgctcaacgtcactctgaacgactctggcctctacacctgcaatgtgtcccgggagtttgagtttgaggcgcatcggccctttgtgaagacgacgcggctgatccccctaagagtcaccgaggaggctggagaggacttcacctctgtggtctcagaaatcatgatgtacatccttctggtcttcctcaccttgtggctgctcatcgagatgatatattgctacagaaaggtctcaaaagccgaagaggcagcccaagaaaacgcgtctgactaccttgccatcccatctgagaacaaggagaactctgcggtaccagtggaggaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tubulin tyrosine ligase-like family, member 9 - cyclic nucleotide binding domain containing 1 - leucine rich repeat transmembrane neuronal 3 - family with sequence similarity 73, member A |