KRTAP19-7-keratin associated protein 19-7 Gene View larger

KRTAP19-7-keratin associated protein 19-7 Gene

PTXBC103838

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRTAP19-7-keratin associated protein 19-7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRTAP19-7-keratin associated protein 19-7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC103838
Product type: DNA & cDNA
Ncbi symbol: KRTAP19-7
Origin species: Human
Product name: KRTAP19-7-keratin associated protein 19-7 Gene
Size: 2ug
Accessions: BC103838
Gene id: 337974
Gene description: keratin associated protein 19-7
Synonyms: KAP19.7; keratin-associated protein 19-7; keratin associated protein 19-7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctactccggcagctactatggaggcctaggctacggctgtggaggattcggtggcctgggctatggctatagctgtggatgtggcagcttccgcagactgggctatggctgtggctatggaggctacagatacagctgctgccacccatcatgctatgggggatactggtcttctggattctattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - keratin associated protein 19-1
- coiled-coil domain containing 140
- coiled-coil domain containing 153
- keratin associated protein 11-1

Reviews

Buy KRTAP19-7-keratin associated protein 19-7 Gene now

Add to cart