No products
Prices are tax excluded
PTXBC130555
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130555 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP11-1 |
| Origin species: | Human |
| Product name: | KRTAP11-1-keratin associated protein 11-1 Gene |
| Size: | 2ug |
| Accessions: | BC130555 |
| Gene id: | 337880 |
| Gene description: | keratin associated protein 11-1 |
| Synonyms: | HACL-1; HACL1; KAP11.1; keratin-associated protein 11-1; high sulfur keratin-associated protein 11.1; keratin associated protein 11-1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccttcaactgctccacaagaaattgctcttccaggcccattggaggacgctgcattgttccagtggcccaagttaccacgacttccaccactgatgctgactgcctgggcggcatctgtttgcccagttccttccagactggctcttggctcctggaccactgtcaagagacctgctgtgagcccactgcttgccagccaacctgttaccggcgaacttcatgtgtctccaacccttgccaggtgacttgctctcgacaaactacctgtatttccaacccctgctcaactacctacagccggccgctcacctttgtctctagtggatgtcagcccctgggaggcatctccagtgtctgccaaccagtgggcggcatctctactgtctgccaaccagtgggaggagtctctactgtctgccagccagcctgtggggtctccaggacgtatcagcagtcctgcgtgtccagctgccgaagaacctgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 13-3 - lipoma HMGIC fusion partner-like 1 - keratin associated protein 13-1 - keratin associated protein 10-3 |