Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CNOT6-CCR4-NOT transcription complex, subunit 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CNOT6-CCR4-NOT transcription complex, subunit 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027476 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CNOT6 |
| Origin species: | Human |
| Product name: | CNOT6-CCR4-NOT transcription complex, subunit 6 Gene |
| Size: | 2ug |
| Accessions: | BC027476 |
| Gene id: | 57472 |
| Gene description: | CCR4-NOT transcription complex, subunit 6 |
| Synonyms: | CCR4; Ccr4a; CCR4-NOT transcription complex subunit 6; carbon catabolite repression 4 protein; carbon catabolite repressor protein 4 homolog; cytoplasmic deadenylase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcatcatgacaatttccagtgaaggtgagctggagctggttggactaatgagactgaggaagcagcttttcctacgatctgcattatgtaatcacaggtccagagagctttatggaagcgggagaggaggagcacttactcatgttgtatttgttaatggaggatgtcatcttttcatagatgctggaactagagtgcacttgttagatgctaaaggtttgagctttacacaaaatgtcttcatctgtatttgttattgtctacaatatatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serine peptidase inhibitor, Kazal type 6 - serine peptidase inhibitor, Kazal type 4 - F-box and leucine-rich repeat protein 21 - F-box and leucine-rich repeat protein 15 |