PTXBC110068
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC110068 |
Product type: | DNA & cDNA |
Ncbi symbol: | SPINK4 |
Origin species: | Human |
Product name: | SPINK4-serine peptidase inhibitor, Kazal type 4 Gene |
Size: | 2ug |
Accessions: | BC110068 |
Gene id: | 27290 |
Gene description: | serine peptidase inhibitor, Kazal type 4 |
Synonyms: | HEL136; PEC-60; PEC60; serine protease inhibitor Kazal-type 4; epididymis luminal protein 136; gastrointestinal peptide; peptide PEC-60 homolog; serine peptidase inhibitor, Kazal type 4 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggccgtccgccagtgggtaatcgccctggccttggctgccctccttgttgtggacagggaagtgccagtggcagcaggaaagctccctttctcaagaatgcccatctgtgaacacatggtagagtctccaacctgttcccagatgtccaacctggtctgcggcactgatgggctcacatatacgaatgaatgccagctctgcttggcccggataaaaaccaaacaggacatccagatcatgaaagatggcaaatgctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - F-box and leucine-rich repeat protein 21 - F-box and leucine-rich repeat protein 15 - F-box and leucine-rich repeat protein 17 - cholinergic receptor, nicotinic, alpha 9 |