Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LTB4R-leukotriene B4 receptor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LTB4R-leukotriene B4 receptor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004545 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LTB4R |
| Origin species: | Human |
| Product name: | LTB4R-leukotriene B4 receptor Gene |
| Size: | 2ug |
| Accessions: | BC004545 |
| Gene id: | 1241 |
| Gene description: | leukotriene B4 receptor |
| Synonyms: | BLT1; BLTR; CMKRL1; GPR16; LTB4R1; LTBR1; P2RY7; P2Y7; leukotriene B4 receptor 1; G protein-coupled receptor 16; LTB4-R 1; LTB4-R1; P2Y purinoceptor 7; chemoattractant receptor-like 1; chemokine receptor-like 1; purinergic receptor P2Y, G-protein coupled, 7; leukotriene B4 receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacactacatcttctgcagcacccccctcactaggtgtagagttcatctctctgctggctatcatcctgctgtcagtggcgctggctgtggggcttcccggcaacagctttgtggtgtggagtatcctgaaaaggatgcagaagcgctctgtcactgccctgatggtgctgaacctggccctggccgacctggccgtattgctcactgctccctttttccttcacttcctggcccaaggcacctggagttttggactggctggttgccgcctgtgtcactatgtctgcggagtcagcatgtacgccagcgtcctgcttatcacggccatgagtctagaccgctcactggcggtggcccgcccctttgtgtcccagaagctacgcaccaaggcgatggcccggcgggtgctggcaggcatctgggtgttgtcctttctgctggccacacccgtcctcgcgtaccgcacagtagtgccctggaaaacgaacatgagcctgtgcttcccgcggtaccccagcgaagggcaccgggccttccatctaatcttcgaggctgtcacgggcttcctgctgcccttcctggctgtggtggccagctactcggacatagggcgtcggctacaggcccggcgcttccgccgcagccgccgcaccggccgcctggtggtgctcatcatcctgaccttcgccgccttctggctgccctaccacgtggtgaacctggctgaggcgggccgcgcgctggccggccaggccgccgggttagggctcgtggggaagcggctgagcctggcccgcaacgtgctcatcgcactcgccttcctgagcagcagcgtgaaccccgtgctgtacgcgtgcgccggcggcggcctgctgcgctcggcgggcgtgggcttcgtcgccaagctgctggagggcacgggctccgaggcgtccagcacgcgccgcgggggcagcctgggccagaccgctaggagcggccccgccgctttggagcccggcccttccgagagcctcactgcctccagccctttcaagttaaacgaactgaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - growth arrest-specific 7 - transducin (beta)-like 3 - tachykinin 4 (hemokinin) - SPANX family, member D |