Login to display prices
Login to display prices
ROR1-receptor tyrosine kinase-like orphan receptor 1 Gene View larger

ROR1-receptor tyrosine kinase-like orphan receptor 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ROR1-receptor tyrosine kinase-like orphan receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ROR1-receptor tyrosine kinase-like orphan receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006374
Product type: DNA & cDNA
Ncbi symbol: ROR1
Origin species: Human
Product name: ROR1-receptor tyrosine kinase-like orphan receptor 1 Gene
Size: 2ug
Accessions: BC006374
Gene id: 4919
Gene description: receptor tyrosine kinase-like orphan receptor 1
Synonyms: inactive tyrosine-protein kinase transmembrane receptor ROR1; NTRKR1; dJ537F10.1; neurotrophic tyrosine kinase, receptor-related 1; receptor tyrosine kinase like orphan receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaccggccgcgccgccgcgggacgcgcccgccgctcctggcgctgctggccgcgctgctgctggccgcacgcggggctgctgcccaagaaacagagctgtcagtcagtgctgaattagtgcctacctcatcatggaacatctcaagtgaactcaacaaagattcttacctgacccttgatgaaccaatgaataacatcaccacgtctctgggccagacagcagaactgcactgcaaagtctctgggaatccacctcccaccatccgctggttcaaaaatgatgctcctgtggtccaggagccccggaggctctcctttcggtccaccatctatggctctcggctgcggattagaaacctcgacaccacagacacaggctacttccagtgcgtggcaacaaacggcaaggaggtggtttcttccactggagtcttgtttgtcaagtttggcccccctcccactgcaagtccaggatactcagatgagtatgaagaagatggattctgtcagccatacagagggattgcatgtgcaagatttattggcaaccgcaccgtctatatggagtctttgcacatgcaaggggaaatagaaaatcagatcacagctgccttcactatgattggcacttccagtcacttatctgataagtgttctcagttcgccattccttccctgtgccactatgccttcccgtactgcgatgaaacttcatccgtcccaaagccccgtgacttgtgtcgcgatgaatgtgaaatcctggagaatgtcctgtgtcaaacagagtacatttttgcaagatcaaatcccatgattctgatgaggctgaaactgccaaactgtgaagatctcccccagccagagagcccagaagctgcgaactgtatccggattggaattcccatggcagatcctataaataaaaatcacaagtgttataacagcacaggtgtggactaccgggggaccgtcagtgtgaccaaatcagggcgccagtgccagccatggaattcccagtatccccacacacacactttcaccgcccttcgtttcccagagctgaatggaggccattcctactgccgcaacccagggaatcaaaaggaagctccctggtgcttcaccttggatgaaaactttaagtctgatctgtgtgacatcccagcttgcggtaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - erythrocyte membrane protein band 4.1-like 3
- dihydrouridine synthase 4-like (S. cerevisiae)
- heart and neural crest derivatives expressed 2
- T cell immunoreceptor with Ig and ITIM domains