Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DUS4L-dihydrouridine synthase 4-like (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DUS4L-dihydrouridine synthase 4-like (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC111774 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DUS4L |
| Origin species: | Human |
| Product name: | DUS4L-dihydrouridine synthase 4-like (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC111774 |
| Gene id: | 11062 |
| Gene description: | dihydrouridine synthase 4-like (S. cerevisiae) |
| Synonyms: | DUS4; PP35; tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like; protein similar to E.coli yhdg and R. capsulatus nifR3; dihydrouridine synthase 4 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagaaggttatggggcttgcttaataaacaagccagagcttgttcaagacatggtgaaacaagtaagaaatcaagtggaaacccctggattttcagtttctattaaaataaggatccatgatgaccttaaaagaactgtagatctttgtcaaaaggctgaagcaacaggagtttcatggattacagtccatggaagaactgctgaagaaagacatcagccagtgcactatgattccattaaaataattaaggaaaatatgtctatacctgtaattgctaatggagacatcagaagcttaaaggaagcagaaaatgtgtggcggattactgggacagatggtgtgatggttgcaagaggactcttagcaaacccggccatgtttgctggatatgaggaaaccccactgaaatgcatctgggactgggttgacattgctcttgaactcgggactccttacatgtgtttccatcaacatttaatgtacatgatggaaaagataacttcaaggcaggaaaaaagggtatttaatgctctgtcaagcacatcagcaatcatagattaccttacagaccattatggcatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heart and neural crest derivatives expressed 2 - T cell immunoreceptor with Ig and ITIM domains - ribonucleotide reductase M2 B (TP53 inducible) - mitochondrial transcription termination factor |