Login to display prices
Login to display prices
SLC1A5-solute carrier family 1 (neutral amino acid transporter), member 5 Gene View larger

SLC1A5-solute carrier family 1 (neutral amino acid transporter), member 5 Gene

PTXBC000062

New product

Data sheet of SLC1A5-solute carrier family 1 (neutral amino acid transporter), member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC1A5-solute carrier family 1 (neutral amino acid transporter), member 5 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC000062
Ncbi symbol: SLC1A5
Product name: SLC1A5-solute carrier family 1 (neutral amino acid transporter), member 5 Gene
Size: 2ug
Accessions: BC000062
Gene id: 6510
Gene description: solute carrier family 1 (neutral amino acid transporter), member 5
Synonyms: AAAT; ASCT2; ATBO; M7V1; M7VS1; R16; RDRC; neutral amino acid transporter B(0); ATB(0); RD114 virus receptor; RD114/simian type D retrovirus receptor; baboon M7 virus receptor; neutral amino acid transporter B; sodium-dependent neutral amino acid transporter type 2; solute carrier family 1 (neutral amino acid transporter), member 5; solute carrier family 1 member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggccgatcctcctcgagactccaaggggctcgcagcggcggagcccaccgccaacgggggcctggcgctggcctccatcgaggaccaaggcgcggcagcaggcggctactgcggttcccgggaccaggtgcgccgctgccttcgagccaacctgcttgtgctgctgacagtggtggccgtggtggccggcgtggcgctgggactgggggtgtcgggggccgggggtgcgctggcgttgggcccggagcgcttgagcgccttcgtcttcccgggcgagctgctgctgcgtctgctgcggatgatcatcttgccgctggtggtgtgcagcttgatcggcggcgccgccagcctggaccccggcgcgctcggccgtctgggcgcctgggcgctgctctttttcctggtcaccacgctgctggcgtcggcgctcggagtgggcttggcgctggctctgcagccgggcgccgcctccgccgccatcaacgcctccgtgggagccgcgggcagtgccgaaaatgcccccagcaaggaggtgctcgattcgttcctggatcttgcgagaaatatcttcccttccaacctggtgtcagcagcctttcgctcatactctaccacctatgaagagaggaatatcaccggaaccagggtgaaggtgcccgtggggcaggaggtggaggggatgaacatcctgggcttggtagtgtttgccatcgtctttggtgtggcgctgcggaagctggggcctgaaggggagctgcttatccgcttcttcaactccttcaatgaggccaccatggttctggtctcctggatcatgtggtacgcccctgtgggcatcatgttcctggtggctggcaagatcgtggagatggaggatgtgggtttactctttgcccgccttggcaagtacattctgtgctgcctgctgggtcacgccatccatgggctcctggtactgcccctcatctacttcctcttcacccgcaaaaacccctaccgcttcctgtggggcatcgtgacgccgctggccactgcctttgggacctcttccagttccgccacgctgccgctgatgatgaagtgcgtggaggagaataatggcgtggccaagcacatcagccgtttcatcctgcccatcggcgccaccgtcaacatggacggtgccgcgctcttccagtgcgtggccgcagtgttcattgcacagctcagccagcagtccttggacttcgtaaagatcatcaccatcctggtcacggccacagcgtccagcgtgggggcagcgggcatccctgctggaggtgtcctcactctggccatcatcctcgaagcagtcaacctcccggtcgaccatatctccttgatcctggctgtggactggctagtcgaccggtcctgtaccgtcctcaatgtagaaggtgacgctctgggggcaggactcctccaaaattacgtggaccgtacggagtcgagaagcacagagcctgagttgatacaagtgaagagtgagctgcccctggatccgctgccactccccactgaggaaggaaaccccctcctcaaacactatcgggggcccgcaggggatgccacggtcgcctctgagaaggaatcagtcatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: