Cart 17 Product Products 6 341,80 € (empty)
No products
To be determined Shipping
6 341,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 341,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 341,80 €
View larger 
PTPRCAP-protein tyrosine phosphatase, receptor type, C-associated protein Gene
PTXBC113859
New product
Data sheet of PTPRCAP-protein tyrosine phosphatase, receptor type, C-associated protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPRCAP-protein tyrosine phosphatase, receptor type, C-associated protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113859 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPRCAP |
| Origin species: | Human |
| Product name: | PTPRCAP-protein tyrosine phosphatase, receptor type, C-associated protein Gene |
| Size: | 2ug |
| Accessions: | BC113859 |
| Gene id: | 5790 |
| Gene description: | protein tyrosine phosphatase, receptor type, C-associated protein |
| Synonyms: | CD45-AP; LPAP; protein tyrosine phosphatase receptor type C-associated protein; CD45 associated protein; PTPRC-associated protein; lymphocyte phosphatase-associated phosphoprotein; protein tyrosine phosphatase, receptor type, c polypeptide-associated protein; protein tyrosine phosphatase, receptor type C associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctctgccctgcaccttagggctcgggatgctgctggccctgccaggggccttgggctcgggtggcagcgcggaggacagcgtgggctccagctctgtcaccgttgtcctgctgctgctgctgctcctactgctggccactggcctagcactggcctggcgccgcctcagccgtgactcagggggctactaccacccggcccgcctaggtgccgcgctgtggggccgcacgcggcgcctgctctgggccagccccccaggtcgctggctgcaggcccgagctgagctggggtccacagacaatgaccttgagcgacaggaggatgagcaggacacagactatgaccacgtcgcggatggtggcctgcaggctgaccctggggaaggcgagcagcaatgtggagaggcgtccagcccagagcaggtccccgtgcgggctgaggaagccagagacagtgacacggagggcgacctggtcctcggctccccaggaccagcgagcgcagggggcagtgctgaggccctgctgagtgacctgcacgcctttgctggcagcgcagcctgggatgacagcgccagggcagctgggggccagggcctccatgtcaccgcactgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 - leucine-rich repeats and calponin homology (CH) domain containing 1 - enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase - resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) |