ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene View larger

ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene

PTXBC004374

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004374
Product type: DNA & cDNA
Ncbi symbol: ACTR1B
Origin species: Human
Product name: ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene
Size: 2ug
Accessions: BC004374
Gene id: 10120
Gene description: ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Synonyms: ARP1B; CTRN2; PC3; beta-centractin; actin-related protein 1B; centractin beta; ARP1 actin-related protein 1 homolog B, centractin beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtcctacgacatcatcgccaaccagcctgtggtcatcgacaacggttcgggggtgattaaagctggctttgcaggagaccagattcccaaatactgtttcccaaactatgtcgggcggccgaagcacatgcgggtgatggctggagccctggagggggacctcttcatcggaccaaaagcagaggagcaccgggggctgctgaccatccgctaccccatggagcacggcgtggtgcgagactggaacgacatggaacgcatctggcagtacgtctactccaaggatcagctgcagaccttctcggaggagcatcctgtgctcctcacggaggccccgctcaacccgagtaagaaccgggagaaggcggcagaggtgttctttgagaccttcaacgtgccggccctgttcatctccatgcaggctgtgctcagtctgtacgcaacaggacgcacgacaggagtggttctagactcaggggacggggtcactcatgctgtgcccatctatgagggctttgccatgcctcactccatcatgcgggtggacattgccggccgcgacgtctcccgctacctccgactcctgctgcgcaaggaaggggttgacttccatacctcggctgagtttgaggttgtccggacaatcaaagagcgagcgtgctacctgtccatcaacccacagaaggatgaggctctggagacggagaaggtgcagtacacgttgccagacggcagcacgcttgatgtggggcctgcacgattccgggcccccgagctgctgttccagccggaccttgtgggggatgagagtgaggggctccatgaggtggtggccttcgccatacacaagtccgacatggacctgcgccggacgctgttcgccaacatcgtgctctcaggtggctcaacgcttttcaaaggcttcggagaccgattactcagtgaagtgaagaagcttgccccaaaggatatcaaaatcaagatctcagccccgcaggaacggctgtactccacatggattggcggctccatcctggcctcgctggacacttttaagaagatgtgggtgtccaaaaaggagtatgaagaggatggctcccgtgctattcatcgcaaaactttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 2-oxoglutarate and iron-dependent oxygenase domain containing 2
- calcium/calmodulin-dependent serine protein kinase (MAGUK family)
- solute carrier family 6 (proline IMINO transporter), member 20
- solute carrier family 22 (organic anion transporter), member 9

Buy ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene now

Add to cart