Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene
PTXBC004374
New product
Data sheet of ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004374 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACTR1B |
| Origin species: | Human |
| Product name: | ACTR1B-ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC004374 |
| Gene id: | 10120 |
| Gene description: | ARP1 actin-related protein 1 homolog B, centractin beta (yeast) |
| Synonyms: | ARP1B; CTRN2; PC3; beta-centractin; actin-related protein 1B; centractin beta; ARP1 actin-related protein 1 homolog B, centractin beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtcctacgacatcatcgccaaccagcctgtggtcatcgacaacggttcgggggtgattaaagctggctttgcaggagaccagattcccaaatactgtttcccaaactatgtcgggcggccgaagcacatgcgggtgatggctggagccctggagggggacctcttcatcggaccaaaagcagaggagcaccgggggctgctgaccatccgctaccccatggagcacggcgtggtgcgagactggaacgacatggaacgcatctggcagtacgtctactccaaggatcagctgcagaccttctcggaggagcatcctgtgctcctcacggaggccccgctcaacccgagtaagaaccgggagaaggcggcagaggtgttctttgagaccttcaacgtgccggccctgttcatctccatgcaggctgtgctcagtctgtacgcaacaggacgcacgacaggagtggttctagactcaggggacggggtcactcatgctgtgcccatctatgagggctttgccatgcctcactccatcatgcgggtggacattgccggccgcgacgtctcccgctacctccgactcctgctgcgcaaggaaggggttgacttccatacctcggctgagtttgaggttgtccggacaatcaaagagcgagcgtgctacctgtccatcaacccacagaaggatgaggctctggagacggagaaggtgcagtacacgttgccagacggcagcacgcttgatgtggggcctgcacgattccgggcccccgagctgctgttccagccggaccttgtgggggatgagagtgaggggctccatgaggtggtggccttcgccatacacaagtccgacatggacctgcgccggacgctgttcgccaacatcgtgctctcaggtggctcaacgcttttcaaaggcttcggagaccgattactcagtgaagtgaagaagcttgccccaaaggatatcaaaatcaagatctcagccccgcaggaacggctgtactccacatggattggcggctccatcctggcctcgctggacacttttaagaagatgtgggtgtccaaaaaggagtatgaagaggatggctcccgtgctattcatcgcaaaactttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 2-oxoglutarate and iron-dependent oxygenase domain containing 2 - calcium/calmodulin-dependent serine protein kinase (MAGUK family) - solute carrier family 6 (proline IMINO transporter), member 20 - solute carrier family 22 (organic anion transporter), member 9 |