Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OGFOD2-2-oxoglutarate and iron-dependent oxygenase domain containing 2 Gene
PTXBC098293
New product
Data sheet of OGFOD2-2-oxoglutarate and iron-dependent oxygenase domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OGFOD2-2-oxoglutarate and iron-dependent oxygenase domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC098293 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OGFOD2 |
| Origin species: | Human |
| Product name: | OGFOD2-2-oxoglutarate and iron-dependent oxygenase domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC098293 |
| Gene id: | 79676 |
| Gene description: | 2-oxoglutarate and iron-dependent oxygenase domain containing 2 |
| Synonyms: | 2-oxoglutarate and iron-dependent oxygenase domain-containing protein 2; 2-oxoglutarate and iron dependent oxygenase domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctaaggggaggcccaacaccatgaacaactacggggtgctgctgcacgagctcgggctggacgagccgctgatgacaccactgcgggagcgcttcctgcagccgctgatggccctgctgtaccctgactgtggcgggggccggctcgacagccaccgggcctttgtggtcaaatacgcaccgggccaggacctggagctgggctgccactatgataatgccgagctcaccctcaatgtggccttgggcaaggtcttcacagggggcgccctgtattttgggggcctcttccaggcacccacagccctgacggagcccctggaggtggagcacgtggtgggccagggtgtcctccaccgtggcggccagctgcatggagcccggcccttgggcactggtgagcgttggaaccttgtcgtctggctccgagcctctgctgtgcgcaacagcctctgtcccatgtgctgccgtgagcccgacctggtggacgatgagggcttcggtgatggcttcacccgagaggagcccgccacggtggatgtatgtgcgctcacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium/calmodulin-dependent serine protein kinase (MAGUK family) - solute carrier family 6 (proline IMINO transporter), member 20 - solute carrier family 22 (organic anion transporter), member 9 - 5-methyltetrahydrofolate-homocysteine methyltransferase reductase |