Login to display prices
Login to display prices
RGS17-regulator of G-protein signaling 17 Gene View larger

RGS17-regulator of G-protein signaling 17 Gene

PTXBC013117

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGS17-regulator of G-protein signaling 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGS17-regulator of G-protein signaling 17 Gene

Proteogenix catalog: PTXBC013117
Ncbi symbol: RGS17
Product name: RGS17-regulator of G-protein signaling 17 Gene
Size: 2ug
Accessions: BC013117
Gene id: 26575
Gene description: regulator of G-protein signaling 17
Synonyms: RGS-17; RGSZ2; hRGS17; regulator of G-protein signaling 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgaaaaaggcagcagtcccaaaatgaaggaacacctgccgtgtctcaagctcctggaaaccagaggcccaacaacacctgttgcttttgttggtgctgttgttgcagctgctcctgcctcactgtgaggaatgaagaaagaggggaaaatgcgggaagacccacacacactacaaaaatggagagtatccaggtcctagaggaatgccaaaaccccactgcagaggaagtcttgtcctggtctcaaaattttgacaagatgatgaaggccccagcaggaagaaaccttttcagagagttcctccgaacagaatacagtgaagagaacctacttttctggcttgcttgtgaagacttaaagaaggagcagaacaaaaaagtaattgaagaaaaggctaggatgatatatgaagattacatttctatactatcaccaaaagaggtcagtcttgattctcgagttagagaggtgatcaatagaaatctgttggatcccaatcctcacatgtatgaagatgcccaacttcagatatatactttaatgcacagagattcttttccaaggtttttgaactctcaaatttataagtcatttgttgaaagtactgctggctcttcttctgaatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: