MGC39584-hypothetical gene supported by BC029568 Gene View larger

MGC39584-hypothetical gene supported by BC029568 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC39584-hypothetical gene supported by BC029568 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC39584-hypothetical gene supported by BC029568 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029568
Product type: DNA & cDNA
Ncbi symbol: MGC39584
Origin species: Human
Product name: MGC39584-hypothetical gene supported by BC029568 Gene
Size: 2ug
Accessions: BC029568
Gene id: 441058
Gene description: hypothetical gene supported by BC029568
Synonyms: uncharacterized LOC441058
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgaaaccccaggcggagacgggggaagcagcacgggatcccagcctcaggcctgcacggacggtgttggttgggtcactttcatggctaagaaagcaactccaacccacacactgcaaatatgaaggaccacgaaaggcacgcaggctctggtttgcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C-type lectin domain family 11, member A
- zinc finger CCCH-type, antiviral 1-like
- heterogeneous nuclear ribonucleoprotein F
- chaperonin containing TCP1, subunit 7 (eta)

Buy MGC39584-hypothetical gene supported by BC029568 Gene now

Add to cart