CLEC11A-C-type lectin domain family 11, member A Gene View larger

CLEC11A-C-type lectin domain family 11, member A Gene

PTXBC005810

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLEC11A-C-type lectin domain family 11, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLEC11A-C-type lectin domain family 11, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005810
Product type: DNA & cDNA
Ncbi symbol: CLEC11A
Origin species: Human
Product name: CLEC11A-C-type lectin domain family 11, member A Gene
Size: 2ug
Accessions: BC005810
Gene id: 6320
Gene description: C-type lectin domain family 11, member A
Synonyms: CLECSF3; LSLCL; P47; SCGF; C-type lectin domain family 11 member A; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 3; C-type lectin superfamily member 3; lymphocyte secreted C-type lectin; lymphocyte secreted long form of C-type lectin; stem cell growth factor; stem cell growth factor; lymphocyte secreted C-type lectin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggcagcctggcttttgggggctttggtggtcccccagctcttgggctttggccatggggctcggggagcagagagggagtgggagggaggctggggaggtgcccaggaggaggagcgggagagggaggccctgatgctgaagcatctgcaggaagccctaggactgcctgctgggaggggggatgagaatcctgccggaactgttgagggaaaagaggactgggagatggaggaggaccagggggaggaagaggaggaggaagcaacgccaaccccatcctccggccccagcccctctcccacccctgaggacatcgtcacttacatcctgggccgcctggccggcctggacgcaggcctgcaccagctgcacgtccgtctgcacgcgttggacacccgcgtggtcgagctgacccaggggctgcggcagctgcggaacgcggcaggcgacacccgcgatgccgtgcaagccctgcaggaggcgcagggtcgcgccgagcgcgagcacggccgcttggagggctgcctgaaggggctgcgcctgggccacaagtgcttcctgctctcgcgcgacttcgaagctcaggcggcggcgcaggcgcggtgcacggcgcggggcgggagcctggcgcagccggcagaccgccagcagatggaggcgctcactcggtacctgcgcgcggcgctcgctccctacaactggcccgtgtggctgggcgtgcacgatcggcgcgccgagggcctctacctcttcgaaaacggccagcgcgtgtccttcttcgcctggcatcgctcaccccgccccgagctcggcgcccagcccagcgcctcgccgcatccgctcagcccggaccagcccaacggtggcacgctcgagaactgcgtggcgcaggcctctgacgacggctcctggtgggaccacgactgccagcggcgtctctactacgtctgcgagttccccttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger CCCH-type, antiviral 1-like
- heterogeneous nuclear ribonucleoprotein F
- chaperonin containing TCP1, subunit 7 (eta)
- cysteine conjugate-beta lyase, cytoplasmic

Buy CLEC11A-C-type lectin domain family 11, member A Gene now

Add to cart