FLYWCH2-FLYWCH family member 2 Gene View larger

FLYWCH2-FLYWCH family member 2 Gene

PTXBC014089

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLYWCH2-FLYWCH family member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLYWCH2-FLYWCH family member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014089
Product type: DNA & cDNA
Ncbi symbol: FLYWCH2
Origin species: Human
Product name: FLYWCH2-FLYWCH family member 2 Gene
Size: 2ug
Accessions: BC014089
Gene id: 114984
Gene description: FLYWCH family member 2
Synonyms: FLYWCH family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccctgcccgagcccagcgagcaggagggtgagagtgtgaaggccagccaggagccatcccccaagccaggcacagaagtcatcccggcagcccccaggaagcccagaaagttctccaaactggtcctgctcacagcctccaaagacagcaccaaggtggcgggggccaagcgcaagggtgtgcactgtgtcatgtccctgggggtgcccggccccgccacccttgccaaggccctcctccagacccaccccgaggcccagcgggccattgaggcagcccctcaggagcctgagcagaaacggagcaggcaggacccaggcacagacagaacagaagacagtggattagcagcggggcctcctgaggctgctggggagaactttgccccctgctctgtggcgcccggcaagtccctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 444
- proline rich 7 (synaptic)
- KIAA0644 gene product
- TRAF interacting protein

Buy FLYWCH2-FLYWCH family member 2 Gene now

Add to cart