PRR7-proline rich 7 (synaptic) Gene View larger

PRR7-proline rich 7 (synaptic) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRR7-proline rich 7 (synaptic) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRR7-proline rich 7 (synaptic) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004261
Product type: DNA & cDNA
Ncbi symbol: PRR7
Origin species: Human
Product name: PRR7-proline rich 7 (synaptic) Gene
Size: 2ug
Accessions: BC004261
Gene id: 80758
Gene description: proline rich 7 (synaptic)
Synonyms: proline-rich protein 7; synaptic proline-rich membrane protein; proline rich 7, synaptic
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgatgtcccagggcacctacacgttcctcacgtgcttcgccggcttctggctcatctggggtctcatcgtcctgctctgctgcttctgcagcttcctgcgccgccgcctcaaacggcgccaggaggagcgactgcgcgagcagaacctgcgcgccctagagctggagcccctcgaactcgagggcagtctggccgggagccccccgggcctggcgccgccgcagccaccaccacaccgtagccgcctggaggcgccggctcacgcgcacgcgcacccacacccgcaccaccacgcgctcccgcacccgccgcctacgcacctgtcggtgccgccacggccctggagctacccgcgccaagcggaatcggacatgtccaaaccaccgtgttacgaagaggcggtgctgatggcagagccgccgccgccctatagcgaggtgctcacggacacgcgcggcctctaccgcaagatcgtcacgcccttcctgagtcgccgcgacagcgcggagaagcaggagcagccgcctcccagctacaagccgctcttcctggaccggggctacacctcggcgctgcacctgcccagcgcccctcggcccgcgccgccctgcccagccctctgcctgcaggccgaccgtggccgccgggtcttccccagctggaccgactcagagctcagcagccgcgagcccctggagcacggagcttggcgtctgccggtctccatccccttgttcgggaggactacagccgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA0644 gene product
- TRAF interacting protein
- replication initiator 1
- short stature homeobox 2

Buy PRR7-proline rich 7 (synaptic) Gene now

Add to cart