ANXA5-annexin A5 Gene View larger

ANXA5-annexin A5 Gene

PTXBC018671

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANXA5-annexin A5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANXA5-annexin A5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018671
Product type: DNA & cDNA
Ncbi symbol: ANXA5
Origin species: Human
Product name: ANXA5-annexin A5 Gene
Size: 2ug
Accessions: BC018671
Gene id: 308
Gene description: annexin A5
Synonyms: ANX5; ENX2; HEL-S-7; PP4; RPRGL3; annexin A5; CBP-I; PAP-I; VAC-alpha; anchorin CII; annexin V; annexin-5; calphobindin I; endonexin II; epididymis secretory protein Li 7; lipocortin V; placental anticoagulant protein 4; placental anticoagulant protein I; thromboplastin inhibitor; vascular anticoagulant-alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacaggttctcagaggcactgtgactgacttccctggatttgatgagcgggctgatgcagaaactcttcggaaggctatgaaaggcttgggcacagatgaggagagcatcctgactctgttgacatcccgaagtaatgctcagcgccaggaaatttctgcagcttttaagactctgtttggcagggatcttctggatgacctgaaatcagaactaactggaaaatttgaaaaattaattgtggctctgatgaaaccctctcggctttatgatgcttatgaactgaaacatgccttgaagggagctggaacaaatgaaaaagtactgacagaaattattgcttcaaggacacctgaagaactgagagccatcaaacaagtttatgaagaagaatatggctcaagcctggaagatgacgtggtgggggacacttcagggtactaccagcggatgttggtggttctccttcaggctaacagagaccctgatgctggaattgatgaagctcaagttgaacaagatgctcaggctttatttcaggctggagaacttaaatgggggacagatgaagaaaagtttatcaccatctttggaacacgaagtgtgtctcatttgagaaaggtgtttgacaagtacatgactatatcaggatttcaaattgaggaaaccattgaccgcgagacttctggcaatttagagcaactactccttgctgttgtgaaatctattcgaagtatacctgcctaccttgcagagaccctctattatgctatgaagggagctgggacagatgatcataccctcatcagagtcatggtttccaggagtgagactgatctgtttaacatcaggaaggagtttaggaagaattttgccacctctctttattccatgattaagggagatacatctggggactataagaaagctcttctgctgctctgtggagaagatgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - t-complex 1
- annexin A3
- jun oncogene
- lipocalin 8

Buy ANXA5-annexin A5 Gene now

Add to cart