Login to display prices
Login to display prices
ANXA5-annexin A5 Gene View larger

ANXA5-annexin A5 Gene

PTXBC018671

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANXA5-annexin A5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANXA5-annexin A5 Gene

Proteogenix catalog: PTXBC018671
Ncbi symbol: ANXA5
Product name: ANXA5-annexin A5 Gene
Size: 2ug
Accessions: BC018671
Gene id: 308
Gene description: annexin A5
Synonyms: ANX5; ENX2; HEL-S-7; PP4; RPRGL3; annexin A5; CBP-I; PAP-I; VAC-alpha; anchorin CII; annexin V; annexin-5; calphobindin I; endonexin II; epididymis secretory protein Li 7; lipocortin V; placental anticoagulant protein 4; placental anticoagulant protein I; thromboplastin inhibitor; vascular anticoagulant-alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacaggttctcagaggcactgtgactgacttccctggatttgatgagcgggctgatgcagaaactcttcggaaggctatgaaaggcttgggcacagatgaggagagcatcctgactctgttgacatcccgaagtaatgctcagcgccaggaaatttctgcagcttttaagactctgtttggcagggatcttctggatgacctgaaatcagaactaactggaaaatttgaaaaattaattgtggctctgatgaaaccctctcggctttatgatgcttatgaactgaaacatgccttgaagggagctggaacaaatgaaaaagtactgacagaaattattgcttcaaggacacctgaagaactgagagccatcaaacaagtttatgaagaagaatatggctcaagcctggaagatgacgtggtgggggacacttcagggtactaccagcggatgttggtggttctccttcaggctaacagagaccctgatgctggaattgatgaagctcaagttgaacaagatgctcaggctttatttcaggctggagaacttaaatgggggacagatgaagaaaagtttatcaccatctttggaacacgaagtgtgtctcatttgagaaaggtgtttgacaagtacatgactatatcaggatttcaaattgaggaaaccattgaccgcgagacttctggcaatttagagcaactactccttgctgttgtgaaatctattcgaagtatacctgcctaccttgcagagaccctctattatgctatgaagggagctgggacagatgatcataccctcatcagagtcatggtttccaggagtgagactgatctgtttaacatcaggaaggagtttaggaagaattttgccacctctctttattccatgattaagggagatacatctggggactataagaaagctcttctgctgctctgtggagaagatgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: