Cart 11 Product Products 2 013,57 € (empty)
-
1 x BLMH-bleom...121,50 € -
-
-
1 x ANXA5-anne...121,50 € -
1 x LSDP5-lipi...121,50 € -
-
-
-
-
1 x PAQR5-prog...121,50 € -
No products
To be determined Shipping
2 013,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 013,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 013,57 €
Data sheet of LCN8-lipocalin 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LCN8-lipocalin 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130465 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LCN8 |
| Origin species: | Human |
| Product name: | LCN8-lipocalin 8 Gene |
| Size: | 2ug |
| Accessions: | BC130465 |
| Gene id: | 138307 |
| Gene description: | lipocalin 8 |
| Synonyms: | EP17; LCN5; epididymal-specific lipocalin-8; lipocalin 5; lipocalin 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagctggaccggcagaagattggaggattctggagggaagtcggtgtggcctccgatcaaagcctggtgctgacggccccgaagcgggtggagggcttgttcctcaccttgagcgggagtaacctgaccgtgaaggttgcatataacagctcaggaagctgtgagatagagaagatcgtgggctcagaaatagacagtacgggaaaattcgcttttcctggccacagagagatccacgtgctggacaccgactacgagggctacgccatcctgcgggtgtccctgatgtggcggggcaggaactttcgcgtcctcaagtactttactcggagccttgaggacaaggaccggctggggttctggaagtttcgggagctgacagcagacactggtctctacctggcggcccggcctgggcggtgtgccgagctcctgaaggaggagctgatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - akirin 1 - uroplakin 2 - keratin 6C - matrilin 4 |