GLYATL2-glycine-N-acyltransferase-like 2 Gene View larger

GLYATL2-glycine-N-acyltransferase-like 2 Gene

PTXBC021682

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLYATL2-glycine-N-acyltransferase-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GLYATL2-glycine-N-acyltransferase-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021682
Product type: DNA & cDNA
Ncbi symbol: GLYATL2
Origin species: Human
Product name: GLYATL2-glycine-N-acyltransferase-like 2 Gene
Size: 2ug
Accessions: BC021682
Gene id: 219970
Gene description: glycine-N-acyltransferase-like 2
Synonyms: BXMAS2-10; GATF-B; glycine N-acyltransferase-like protein 2; acyl-CoA:glycine N-acyltransferase-like protein 2; glycine acyltransferase family-B; glycine-N-acyltransferase like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttgtgcttcataactctcagaagctgcagattctgtataaatccttagaaaagagcatccctgaatccataaaggtatatggcgccattttcaacataaaagataaaaaccctttcaacatggaggtgctggtagatgcctggccagattaccagatcgtcattacccggcctcagaaacaggagatgaaagatgaccaggatcattataccaacacttaccacatcttcaccaaagctcctgacaaattagaggaagtcctgtcatactccaatgtaatcagctgggagcaaactttgcagatccaaggttgccaagagggcttggatgaagcaataagaaaggttgcaacttcaaaatcagtgcaggtagattacatgaaaaccatcctctttataccggaattaccaaagaaacacaagacctcaagtaatgacaagatggagttatttgaagtggatgatgataacaaggaaggaaacttttcaaacatgttcttagatgcttcacatgcaggtcttgtgaatgaacactgggcctttgggaaaaatgagaggagcttgaaatatattgaacgctgcctccaggattttctaggatttggtgtgctgggtccagagggccagcttgtctcttggattgtgatggaacagtcctgtgagttgagaatgggttatactgtccccaaatacagacaccaaggcaacatgttgcaaattggttatcatcttgaaaagtatctttctcagaaagaaatcccattttatttccatgtggcagataataatgagaaaagcctacaggcactgaacaatttggggtttaagatttgtccttgtggctggcatcagtggaaatgcacccccaagaaatattgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 4 open reading frame 3
- acetylserotonin O-methyltransferase
- carboxypeptidase, vitellogenic-like
- tetratricopeptide repeat domain 17

Buy GLYATL2-glycine-N-acyltransferase-like 2 Gene now

Add to cart