Login to display prices
Login to display prices
C4orf3-chromosome 4 open reading frame 3 Gene View larger

C4orf3-chromosome 4 open reading frame 3 Gene

PTXBC017399

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C4orf3-chromosome 4 open reading frame 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C4orf3-chromosome 4 open reading frame 3 Gene

Proteogenix catalog: PTXBC017399
Ncbi symbol: C4orf3
Product name: C4orf3-chromosome 4 open reading frame 3 Gene
Size: 2ug
Accessions: BC017399
Gene id: 401152
Gene description: chromosome 4 open reading frame 3
Synonyms: uncharacterized protein C4orf3; HCVFTP1; HCV F-transactivated protein 1; hepatitis C virus F protein-transactivated protein 1; chromosome 4 open reading frame 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtggacgcaccgggtgttgatggtcgagatggtctccgggagcagcgaggctttagcgagggagggaggcagaacttcgatgtgaggcctcagtctggggcaaatgggcttcccaaacactcctactggttggacctctggcttttcatccttttcgatgtggtggtgtttctctttgtgtattttttgccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: