Login to display prices
Login to display prices
PIH1D2-PIH1 domain containing 2 Gene View larger

PIH1D2-PIH1 domain containing 2 Gene

PTXBC019238

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIH1D2-PIH1 domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIH1D2-PIH1 domain containing 2 Gene

Proteogenix catalog: PTXBC019238
Ncbi symbol: PIH1D2
Product name: PIH1D2-PIH1 domain containing 2 Gene
Size: 2ug
Accessions: BC019238
Gene id: 120379
Gene description: PIH1 domain containing 2
Synonyms: PIH1 domain-containing protein 2; PIH1 domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacatcctcaaaaggtctgcttacccaagttactcagttttggaacctcctagatgatctagctcagagtgaccctgagggctatgagaagtttattcagcagcagctgaaagaagggaaacagctctgtgctgccccagaaccacagctttgtctacagaccaggattctgaaaccaaaagaaaaaatactttttatcaacctgtgtcagtggacaaggatcccagctccccaatcaaccactcatccagtacctctaactgttggcaaaccagaagatacaactgagatatcagatgcttacacagtcattgatgttgcctacaatcctgatgttcttcatgcagcagaaaaggaccaagtgaaaaaaaatcagttaattcagatggccatgaaatgcattgaggagaaattccagttcaccctctcacactcttaccatattaccaaatttagaataaaaggaagcattcaaagaatgaaacaaaatctgatgggaatccaaactgattccatagatttaagagaaaaaatgagaagggaactaactcttggacagatacgaagcagtactatgagcaatccagatcactttcctcaactgttactgccaaaagaccaagtttcaggcaaagcagtgtgtctgatagaagagatttccagtactgaaatccaggtggagatgaagatgccagcctatgaactaaaaattgtgcatgatcacagtgagaaacctctgaaaattgagttgaaagttgaattacctggtattaattctgtctctctctgtgaccttagtgtttctgaggatgatttattgattgaagtatctgagaagtacagattacatctgaatcttccaaaacttattgatactgaaatgaccacagcaaaatttatcaaagaaaaatccacgctaatcatcacaatgcctttggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: